Incidental Mutation 'R2882:Gsdmc'
ID260363
Institutional Source Beutler Lab
Gene Symbol Gsdmc
Ensembl Gene ENSMUSG00000079025
Gene Namegasdermin C
SynonymsMlze, Gsdmc1
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location63775968-63808759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63779795 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 259 (I259V)
Ref Sequence ENSEMBL: ENSMUSP00000105752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110125] [ENSMUST00000173503]
Predicted Effect probably benign
Transcript: ENSMUST00000110125
AA Change: I259V

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105752
Gene: ENSMUSG00000079025
AA Change: I259V

DomainStartEndE-ValueType
Pfam:Gasdermin 4 444 6.2e-170 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173503
AA Change: I259V

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133683
Gene: ENSMUSG00000079025
AA Change: I259V

DomainStartEndE-ValueType
Pfam:Gasdermin 4 435 9.6e-157 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Gsdmc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Gsdmc APN 15 63804421 missense probably benign 0.41
IGL00791:Gsdmc APN 15 63804435 missense possibly damaging 0.85
IGL01889:Gsdmc APN 15 63780003 missense possibly damaging 0.89
IGL01917:Gsdmc APN 15 63778585 missense probably benign
IGL01948:Gsdmc APN 15 63778581 missense probably damaging 1.00
IGL02391:Gsdmc APN 15 63803579 missense probably damaging 0.99
IGL02479:Gsdmc APN 15 63777975 missense possibly damaging 0.87
IGL02551:Gsdmc APN 15 63801933 missense probably benign 0.00
R0115:Gsdmc UTSW 15 63803637 missense probably damaging 0.99
R1523:Gsdmc UTSW 15 63803630 missense probably damaging 0.99
R1655:Gsdmc UTSW 15 63780043 missense probably benign 0.42
R1990:Gsdmc UTSW 15 63801899 missense probably benign 0.12
R1991:Gsdmc UTSW 15 63801899 missense probably benign 0.12
R2267:Gsdmc UTSW 15 63776798 missense probably benign 0.12
R2943:Gsdmc UTSW 15 63803652 missense possibly damaging 0.91
R4110:Gsdmc UTSW 15 63780027 missense probably benign 0.08
R4712:Gsdmc UTSW 15 63779537 missense probably benign 0.01
R4963:Gsdmc UTSW 15 63804380 critical splice donor site probably null
R4997:Gsdmc UTSW 15 63776780 missense probably damaging 1.00
R5032:Gsdmc UTSW 15 63802033 missense possibly damaging 0.63
R5276:Gsdmc UTSW 15 63801957 missense probably benign 0.25
R5346:Gsdmc UTSW 15 63776886 missense probably damaging 1.00
R5963:Gsdmc UTSW 15 63780116 splice site probably null
R5965:Gsdmc UTSW 15 63804598 critical splice acceptor site probably null
R6872:Gsdmc UTSW 15 63778707 missense possibly damaging 0.79
R7035:Gsdmc UTSW 15 63778720 splice site probably null
R7408:Gsdmc UTSW 15 63804466 missense probably benign
R7719:Gsdmc UTSW 15 63778964 splice site probably null
R7862:Gsdmc UTSW 15 63777996 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TCCTAGAAAGAGAAACCTGAGCTG -3'
(R):5'- CTACCTGGCATGGGTTTATCG -3'

Sequencing Primer
(F):5'- TTGAGACACACATTGGAACATCTC -3'
(R):5'- CATGGGTTTATCGTAGGAAATTTCTC -3'
Posted On2015-01-23