Incidental Mutation 'R2882:Cyp4f40'
ID260364
Institutional Source Beutler Lab
Gene Symbol Cyp4f40
Ensembl Gene ENSMUSG00000090700
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 40
SynonymsEG631304
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32659410-32676687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32668073 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 173 (I173V)
Ref Sequence ENSEMBL: ENSMUSP00000129536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165061]
Predicted Effect probably benign
Transcript: ENSMUST00000165061
AA Change: I173V

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129536
Gene: ENSMUSG00000090700
AA Change: I173V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 52 515 2.2e-130 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F11, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F2, is approximately 16 kb away. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atp9a T C 2: 168,706,214 Y7C probably damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Cyp4f40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Cyp4f40 APN 17 32667974 missense probably benign 0.00
IGL01563:Cyp4f40 APN 17 32673956 missense probably damaging 0.99
IGL01801:Cyp4f40 APN 17 32676305 missense probably damaging 1.00
IGL01960:Cyp4f40 APN 17 32659561 missense probably benign 0.25
IGL02387:Cyp4f40 APN 17 32668010 missense probably damaging 1.00
IGL02631:Cyp4f40 APN 17 32675635 splice site probably benign
IGL02967:Cyp4f40 APN 17 32674248 missense probably damaging 1.00
R0030:Cyp4f40 UTSW 17 32675973 missense probably damaging 1.00
R0103:Cyp4f40 UTSW 17 32676308 missense probably damaging 1.00
R0103:Cyp4f40 UTSW 17 32676309 nonsense probably null
R0180:Cyp4f40 UTSW 17 32659667 missense probably benign 0.00
R1413:Cyp4f40 UTSW 17 32673939 missense probably benign 0.35
R3903:Cyp4f40 UTSW 17 32659624 missense possibly damaging 0.51
R4378:Cyp4f40 UTSW 17 32668029 missense probably null 0.44
R4465:Cyp4f40 UTSW 17 32671212 missense probably benign 0.00
R4808:Cyp4f40 UTSW 17 32674275 missense probably benign 0.23
R5377:Cyp4f40 UTSW 17 32675616 missense probably null 0.61
R5395:Cyp4f40 UTSW 17 32669853 missense probably benign 0.01
R5523:Cyp4f40 UTSW 17 32669822 missense probably damaging 0.98
R5889:Cyp4f40 UTSW 17 32675757 missense probably benign 0.15
R6624:Cyp4f40 UTSW 17 32671180 missense possibly damaging 0.82
R6692:Cyp4f40 UTSW 17 32675742 missense possibly damaging 0.48
R6859:Cyp4f40 UTSW 17 32675949 missense probably benign 0.19
R7792:Cyp4f40 UTSW 17 32671169 missense probably damaging 1.00
R8324:Cyp4f40 UTSW 17 32659528 missense probably benign 0.35
Z1088:Cyp4f40 UTSW 17 32674002 splice site probably null
Z1177:Cyp4f40 UTSW 17 32671159 missense probably benign 0.04
Z1177:Cyp4f40 UTSW 17 32676449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCCTTGCAGGTGAGATGG -3'
(R):5'- CGACTCCATGGTATCATCATGAAC -3'

Sequencing Primer
(F):5'- TGCAGGTGAGATGGTTGGGAAC -3'
(R):5'- TCCATGGTATCATCATGAACACAGAG -3'
Posted On2015-01-23