Incidental Mutation 'R2873:Kpna7'
ID260402
Institutional Source Beutler Lab
Gene Symbol Kpna7
Ensembl Gene ENSMUSG00000038770
Gene Namekaryopherin alpha 7 (importin alpha 8)
SynonymsLOC381686
MMRRC Submission 040461-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R2873 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144983519-145084030 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144993935 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 367 (T367A)
Ref Sequence ENSEMBL: ENSMUSP00000106301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110672] [ENSMUST00000110673] [ENSMUST00000116454]
Predicted Effect probably benign
Transcript: ENSMUST00000110672
AA Change: T346A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000106300
Gene: ENSMUSG00000038770
AA Change: T346A

DomainStartEndE-ValueType
Pfam:IBB 2 91 1.7e-14 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 6.18e-10 SMART
ARM 185 226 1.78e-1 SMART
ARM 229 268 4.28e-4 SMART
ARM 270 310 1.19e-2 SMART
ARM 312 352 5.27e-4 SMART
ARM 354 393 2.85e0 SMART
ARM 396 436 8.17e-1 SMART
low complexity region 486 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110673
AA Change: T367A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106301
Gene: ENSMUSG00000038770
AA Change: T367A

DomainStartEndE-ValueType
Pfam:IBB 6 90 2.7e-19 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 3.31e-10 SMART
ARM 206 247 1.78e-1 SMART
ARM 250 289 4.28e-4 SMART
ARM 291 331 1.19e-2 SMART
ARM 333 373 5.27e-4 SMART
ARM 375 414 2.85e0 SMART
ARM 417 457 8.17e-1 SMART
Pfam:Arm_3 466 517 8.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116454
AA Change: T346A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000112155
Gene: ENSMUSG00000038770
AA Change: T346A

DomainStartEndE-ValueType
Pfam:IBB 2 91 1.7e-14 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 6.18e-10 SMART
ARM 185 226 1.78e-1 SMART
ARM 229 268 4.28e-4 SMART
ARM 270 310 1.19e-2 SMART
ARM 312 352 5.27e-4 SMART
ARM 354 393 2.85e0 SMART
ARM 396 436 8.17e-1 SMART
low complexity region 486 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142866
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import, but exhibits different nuclear localization signal binding specificity compared to other members of the family. A pseudogene of this gene has been defined on chromosome 5. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display smaller litter sizes with preferential loss of females and accelerated cell cycles post fertilization resulting in loss of embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
Acvr1 G A 2: 58,477,796 Q118* probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd40 T C 11: 94,333,945 V60A possibly damaging Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp13a2 T C 4: 141,002,983 I773T probably benign Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Ccdc162 G T 10: 41,655,099 T537N possibly damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd101 A T 3: 101,003,848 D831E probably benign Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Chek2 C A 5: 110,863,336 Y333* probably null Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Flnc A G 6: 29,447,543 D1115G probably damaging Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm5519 A C 19: 33,825,010 D151A possibly damaging Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Ndufs1 A G 1: 63,164,723 probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pms2 G A 5: 143,911,914 probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ptger4 T C 15: 5,234,805 R457G probably benign Het
Pzp A T 6: 128,485,556 probably null Het
Ralgds A G 2: 28,548,769 probably null Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc4a4 G T 5: 89,135,764 V481L probably damaging Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Slit3 G T 11: 35,544,793 E184* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tet2 C T 3: 133,486,954 G573E probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Usp9y T A Y: 1,310,502 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Kpna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Kpna7 APN 5 145007246 missense probably damaging 1.00
IGL01505:Kpna7 APN 5 144992851 missense probably damaging 1.00
IGL02009:Kpna7 APN 5 144994078 critical splice acceptor site probably null
IGL02365:Kpna7 APN 5 144985733 missense possibly damaging 0.49
IGL02947:Kpna7 APN 5 144994074 missense probably damaging 1.00
IGL03195:Kpna7 APN 5 144997037 missense probably damaging 1.00
IGL03236:Kpna7 APN 5 144985694 missense unknown
IGL03333:Kpna7 APN 5 145005955 missense possibly damaging 0.48
PIT4515001:Kpna7 UTSW 5 145005052 missense probably benign 0.17
R0027:Kpna7 UTSW 5 144989697 missense probably damaging 0.99
R0421:Kpna7 UTSW 5 144989741 missense possibly damaging 0.82
R0463:Kpna7 UTSW 5 145007994 missense possibly damaging 0.66
R2229:Kpna7 UTSW 5 144989697 missense probably damaging 0.99
R2871:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R2871:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R2874:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R4079:Kpna7 UTSW 5 145005927 missense possibly damaging 0.82
R5841:Kpna7 UTSW 5 144993956 missense possibly damaging 0.73
R5888:Kpna7 UTSW 5 144989795 missense probably damaging 0.98
R6188:Kpna7 UTSW 5 144992844 missense probably damaging 1.00
R7163:Kpna7 UTSW 5 145002396 missense unknown
R7502:Kpna7 UTSW 5 145005921 missense probably benign 0.07
R7727:Kpna7 UTSW 5 145005045 missense probably benign 0.19
X0021:Kpna7 UTSW 5 145007233 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCTGACTCCCATCTGAGATTTG -3'
(R):5'- CAGGTTTGCAATCCTTAGACAC -3'

Sequencing Primer
(F):5'- CTAGAGCTCAGACTGGCTTTACG -3'
(R):5'- AGGTTTGCAATCCTTAGACACCTTTC -3'
Posted On2015-01-23