Incidental Mutation 'R2873:Nomo1'
ID260411
Institutional Source Beutler Lab
Gene Symbol Nomo1
Ensembl Gene ENSMUSG00000030835
Gene Namenodal modulator 1
SynonymsPM5, D7Ertd156e, Nomo
MMRRC Submission 040461-MU
Accession Numbers

NCBI RefSeq: NM_153057.4; MGI: 2385850

Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R2873 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46033698-46084212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46046937 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 293 (T293N)
Ref Sequence ENSEMBL: ENSMUSP00000033121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033121]
Predicted Effect probably damaging
Transcript: ENSMUST00000033121
AA Change: T293N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033121
Gene: ENSMUSG00000030835
AA Change: T293N

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
internal_repeat_1 22 215 2.35e-7 PROSPERO
Pfam:CarboxypepD_reg 322 395 3.5e-12 PFAM
Pfam:DUF2012 331 401 5.7e-10 PFAM
low complexity region 709 732 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
Blast:FN3 913 1017 6e-22 BLAST
low complexity region 1156 1164 N/A INTRINSIC
low complexity region 1203 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182564
Meta Mutation Damage Score 0.3060 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (81/81)
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
Acvr1 G A 2: 58,477,796 Q118* probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd40 T C 11: 94,333,945 V60A possibly damaging Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp13a2 T C 4: 141,002,983 I773T probably benign Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Ccdc162 G T 10: 41,655,099 T537N possibly damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd101 A T 3: 101,003,848 D831E probably benign Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Chek2 C A 5: 110,863,336 Y333* probably null Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Flnc A G 6: 29,447,543 D1115G probably damaging Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm5519 A C 19: 33,825,010 D151A possibly damaging Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Ndufs1 A G 1: 63,164,723 probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pms2 G A 5: 143,911,914 probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ptger4 T C 15: 5,234,805 R457G probably benign Het
Pzp A T 6: 128,485,556 probably null Het
Ralgds A G 2: 28,548,769 probably null Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc4a4 G T 5: 89,135,764 V481L probably damaging Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Slit3 G T 11: 35,544,793 E184* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tet2 C T 3: 133,486,954 G573E probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Usp9y T A Y: 1,310,502 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Nomo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Nomo1 APN 7 46045336 missense possibly damaging 0.66
IGL00811:Nomo1 APN 7 46083308 missense possibly damaging 0.95
IGL01710:Nomo1 APN 7 46038556 missense probably damaging 1.00
IGL01797:Nomo1 APN 7 46056662 missense probably damaging 0.96
IGL01973:Nomo1 APN 7 46083227 splice site probably benign
IGL02506:Nomo1 APN 7 46078056 missense possibly damaging 0.50
IGL02739:Nomo1 APN 7 46044307 splice site probably null
IGL02863:Nomo1 APN 7 46046916 missense probably damaging 0.98
P0005:Nomo1 UTSW 7 46037557 critical splice acceptor site probably null
PIT4243001:Nomo1 UTSW 7 46044281 missense probably damaging 1.00
R0106:Nomo1 UTSW 7 46037632 missense probably damaging 1.00
R0106:Nomo1 UTSW 7 46037632 missense probably damaging 1.00
R0124:Nomo1 UTSW 7 46083228 splice site probably benign
R0239:Nomo1 UTSW 7 46079594 critical splice donor site probably null
R0239:Nomo1 UTSW 7 46079594 critical splice donor site probably null
R0417:Nomo1 UTSW 7 46068698 missense possibly damaging 0.51
R0467:Nomo1 UTSW 7 46072487 splice site probably null
R0535:Nomo1 UTSW 7 46072517 missense probably damaging 0.99
R0829:Nomo1 UTSW 7 46076172 splice site probably benign
R0940:Nomo1 UTSW 7 46033905 missense possibly damaging 0.56
R1480:Nomo1 UTSW 7 46060913 missense probably damaging 0.98
R1601:Nomo1 UTSW 7 46046955 missense probably damaging 0.96
R1743:Nomo1 UTSW 7 46070037 critical splice donor site probably null
R1765:Nomo1 UTSW 7 46066293 missense possibly damaging 0.59
R1861:Nomo1 UTSW 7 46078101 missense probably benign 0.06
R1998:Nomo1 UTSW 7 46033944 missense possibly damaging 0.69
R1999:Nomo1 UTSW 7 46056727 missense possibly damaging 0.95
R2145:Nomo1 UTSW 7 46066504 missense probably damaging 1.00
R2869:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2869:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2870:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2870:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2871:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2871:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R4116:Nomo1 UTSW 7 46033896 missense probably benign 0.06
R4404:Nomo1 UTSW 7 46056668 missense probably benign 0.00
R4406:Nomo1 UTSW 7 46056668 missense probably benign 0.00
R4560:Nomo1 UTSW 7 46041480 missense probably damaging 0.99
R4633:Nomo1 UTSW 7 46050260 splice site probably benign
R4651:Nomo1 UTSW 7 46068442 missense probably damaging 0.99
R4653:Nomo1 UTSW 7 46061813 missense probably benign 0.01
R4752:Nomo1 UTSW 7 46057202 missense probably damaging 1.00
R4792:Nomo1 UTSW 7 46044219 splice site probably null
R4838:Nomo1 UTSW 7 46083715 missense unknown
R4876:Nomo1 UTSW 7 46066491 missense probably damaging 1.00
R4915:Nomo1 UTSW 7 46044232 missense probably benign 0.30
R4953:Nomo1 UTSW 7 46050731 intron probably benign
R5463:Nomo1 UTSW 7 46063002 missense possibly damaging 0.47
R5664:Nomo1 UTSW 7 46076157 missense probably benign
R5956:Nomo1 UTSW 7 46042613 missense possibly damaging 0.51
R6037:Nomo1 UTSW 7 46062999 missense possibly damaging 0.64
R6037:Nomo1 UTSW 7 46062999 missense possibly damaging 0.64
R6307:Nomo1 UTSW 7 46033836 unclassified probably benign
R6695:Nomo1 UTSW 7 46066461 missense probably benign 0.16
R6970:Nomo1 UTSW 7 46045967 missense probably damaging 0.97
R7334:Nomo1 UTSW 7 46083268 missense probably damaging 1.00
R7394:Nomo1 UTSW 7 46066479 missense probably benign 0.26
R7556:Nomo1 UTSW 7 46066218 missense probably damaging 1.00
R7834:Nomo1 UTSW 7 46056738 critical splice donor site probably null
R7917:Nomo1 UTSW 7 46056738 critical splice donor site probably null
Z1177:Nomo1 UTSW 7 46066273 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TAGGTTGCAAGTGGGTCACAG -3'
(R):5'- AGAGGAAGTACACCTATGGTACC -3'

Sequencing Primer
(F):5'- TCACAGTAGAGTGCAAGGCTTCTC -3'
(R):5'- AGTACACCTATGGTACCCCGGG -3'
Posted On2015-01-23