Incidental Mutation 'R0331:Pdgfra'
ID26042
Institutional Source Beutler Lab
Gene Symbol Pdgfra
Ensembl Gene ENSMUSG00000029231
Gene Nameplatelet derived growth factor receptor, alpha polypeptide
SynonymsPdgfr-2, CD140a
MMRRC Submission 038540-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0331 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location75152292-75198215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75195052 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1074 (D1074E)
Ref Sequence ENSEMBL: ENSMUSP00000127173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000476] [ENSMUST00000168162]
Predicted Effect probably damaging
Transcript: ENSMUST00000000476
AA Change: D1074E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000476
Gene: ENSMUSG00000029231
AA Change: D1074E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168162
AA Change: D1074E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127173
Gene: ENSMUSG00000029231
AA Change: D1074E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Meta Mutation Damage Score 0.0883 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.7%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes for targeted null mutations exhibit incomplete cephalic closure, increased apoptosis of neural crest cells, impaired myotome and testis formation, abnormal mucosal linings, thoracic skeletal defects, and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,229,392 T79S probably benign Het
Abtb1 T C 6: 88,840,702 probably benign Het
Acot12 G A 13: 91,760,064 probably null Het
Adamts4 T A 1: 171,250,972 S54T probably benign Het
Adgrl4 T C 3: 151,497,940 S96P probably benign Het
Aip G T 19: 4,118,247 T40K probably damaging Het
Anapc4 A G 5: 52,855,642 probably benign Het
Asz1 A G 6: 18,103,619 probably benign Het
Atf7ip A G 6: 136,561,163 T465A possibly damaging Het
Atp11a C T 8: 12,816,953 Q127* probably null Het
Axin1 A G 17: 26,143,107 R142G probably damaging Het
B230359F08Rik A G 14: 53,795,748 N38S probably benign Het
Bcat1 T A 6: 145,047,314 E86V probably benign Het
Brd4 G A 17: 32,202,515 P749L probably benign Het
C1ra G A 6: 124,519,435 probably null Het
Capza2 A T 6: 17,665,103 N237I probably benign Het
Cd2ap A T 17: 42,805,301 V556E probably benign Het
Cfap65 G A 1: 74,929,301 P124L probably damaging Het
Cfap65 G T 1: 74,929,302 P124T probably damaging Het
Cftr T C 6: 18,235,226 V488A possibly damaging Het
Ckmt1 A T 2: 121,362,856 probably null Het
Cmya5 T G 13: 93,144,403 E35A possibly damaging Het
Col7a1 A G 9: 108,967,502 probably benign Het
Crmp1 C T 5: 37,265,313 L155F possibly damaging Het
Cyp2d10 T A 15: 82,407,026 T33S probably benign Het
Dhdh T C 7: 45,488,120 K48E probably benign Het
Dlst T C 12: 85,118,812 V103A probably damaging Het
Dohh C T 10: 81,387,812 T233I probably benign Het
Dvl2 C A 11: 70,006,217 probably benign Het
Eipr1 C T 12: 28,864,704 Q286* probably null Het
Enpp6 C A 8: 47,082,449 T343K probably damaging Het
Fbxw11 T A 11: 32,711,895 F112I probably damaging Het
Gdpd4 T A 7: 97,973,008 N231K probably benign Het
Gm6370 A T 5: 146,493,766 T254S probably benign Het
Hapln4 G T 8: 70,084,509 Q31H probably damaging Het
Hic1 T A 11: 75,165,490 T858S possibly damaging Het
Isg20l2 T C 3: 87,931,785 L101P probably damaging Het
Itga10 T C 3: 96,652,483 Y485H probably damaging Het
Itgal T A 7: 127,306,681 probably null Het
Itln1 T C 1: 171,531,549 N62S probably damaging Het
Kdm4b T C 17: 56,386,289 probably benign Het
Lct T C 1: 128,298,742 probably benign Het
Lman2 A T 13: 55,353,016 H123Q probably damaging Het
Lztr1 T A 16: 17,524,237 probably benign Het
Myo3b G T 2: 70,095,261 G24V probably damaging Het
Nacad T A 11: 6,599,441 Q1250L possibly damaging Het
Ncor2 A T 5: 125,084,917 M431K unknown Het
Nek9 T A 12: 85,327,375 probably benign Het
Neu1 C A 17: 34,934,170 N255K possibly damaging Het
Nf2 T A 11: 4,794,914 T75S probably benign Het
Nipal4 T A 11: 46,150,213 D385V probably damaging Het
Olah T A 2: 3,342,474 N245I probably damaging Het
Olfr474 G T 7: 107,954,870 L76F probably benign Het
Pag1 T A 3: 9,701,970 T90S probably benign Het
Pald1 A G 10: 61,340,929 probably null Het
Parva A G 7: 112,544,798 M98V probably benign Het
Paxbp1 T A 16: 91,037,367 D177V possibly damaging Het
Paxip1 A G 5: 27,765,232 I587T probably damaging Het
Pclo T C 5: 14,680,376 probably benign Het
Pef1 A T 4: 130,127,448 D265V probably damaging Het
Plekhh2 G A 17: 84,586,366 E870K possibly damaging Het
Plscr4 G A 9: 92,482,642 G40D probably damaging Het
Psg18 A G 7: 18,353,308 Y142H probably benign Het
Ptchd3 A T 11: 121,842,191 M636L probably benign Het
Rab2a A G 4: 8,572,559 D51G probably benign Het
Rnf139 T A 15: 58,899,906 D593E probably benign Het
Sept7 A G 9: 25,306,256 N422S probably benign Het
Shprh T C 10: 11,194,170 probably benign Het
Slc7a6os A G 8: 106,210,567 I87T probably damaging Het
Slc7a7 A G 14: 54,377,924 probably benign Het
Spc24 G T 9: 21,757,313 N129K possibly damaging Het
Strip2 C T 6: 29,926,560 T148I probably benign Het
Tmem150c A C 5: 100,086,273 probably null Het
Ttn G T 2: 76,811,020 Y11801* probably null Het
Usp37 A T 1: 74,454,064 L688* probably null Het
Usp38 T C 8: 80,995,840 I351V probably benign Het
Vav2 T A 2: 27,296,175 M223L probably benign Het
Wdr36 A G 18: 32,852,915 I557M possibly damaging Het
Wwc2 A T 8: 47,880,204 M259K probably benign Het
Znfx1 G A 2: 167,046,978 S770L probably benign Het
Other mutations in Pdgfra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pdgfra APN 5 75163679 missense probably benign 0.40
IGL00574:Pdgfra APN 5 75181047 missense probably damaging 1.00
IGL00906:Pdgfra APN 5 75180173 missense probably benign 0.00
IGL00964:Pdgfra APN 5 75175065 missense probably damaging 1.00
IGL01467:Pdgfra APN 5 75185631 critical splice donor site probably null
IGL01485:Pdgfra APN 5 75163652 missense probably benign 0.02
IGL01556:Pdgfra APN 5 75177691 missense probably damaging 1.00
IGL01949:Pdgfra APN 5 75170665 missense probably damaging 0.98
IGL02066:Pdgfra APN 5 75170580 missense possibly damaging 0.55
IGL02271:Pdgfra APN 5 75187906 missense probably damaging 1.00
IGL02726:Pdgfra APN 5 75194957 nonsense probably null
IGL02858:Pdgfra APN 5 75194974 missense probably damaging 1.00
IGL03306:Pdgfra APN 5 75192533 missense possibly damaging 0.49
Pony_express UTSW 5 75189234 nonsense probably null
P0033:Pdgfra UTSW 5 75192561 missense probably damaging 1.00
PIT4472001:Pdgfra UTSW 5 75180246 missense probably damaging 1.00
R0134:Pdgfra UTSW 5 75166511 missense probably damaging 1.00
R0200:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0254:Pdgfra UTSW 5 75167935 missense probably damaging 1.00
R0467:Pdgfra UTSW 5 75195036 missense probably damaging 1.00
R0532:Pdgfra UTSW 5 75170773 missense probably benign 0.00
R0608:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0765:Pdgfra UTSW 5 75187987 unclassified probably benign
R1171:Pdgfra UTSW 5 75173447 missense probably damaging 0.98
R1372:Pdgfra UTSW 5 75189263 missense probably damaging 0.96
R1530:Pdgfra UTSW 5 75189010 splice site probably null
R1585:Pdgfra UTSW 5 75192603 missense probably damaging 1.00
R1666:Pdgfra UTSW 5 75189020 missense possibly damaging 0.94
R1836:Pdgfra UTSW 5 75183014 missense possibly damaging 0.95
R1868:Pdgfra UTSW 5 75170873 missense probably benign 0.43
R1923:Pdgfra UTSW 5 75163733 missense probably benign 0.03
R2075:Pdgfra UTSW 5 75187948 missense probably damaging 1.00
R2261:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R2262:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R3028:Pdgfra UTSW 5 75174981 missense probably damaging 1.00
R3236:Pdgfra UTSW 5 75167936 missense probably damaging 1.00
R3692:Pdgfra UTSW 5 75189287 missense possibly damaging 0.54
R3701:Pdgfra UTSW 5 75180220 nonsense probably null
R3890:Pdgfra UTSW 5 75167927 missense probably null 0.57
R3901:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R3902:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R4272:Pdgfra UTSW 5 75183070 missense probably benign 0.05
R4532:Pdgfra UTSW 5 75181083 missense probably damaging 1.00
R4660:Pdgfra UTSW 5 75162271 missense possibly damaging 0.82
R4753:Pdgfra UTSW 5 75181524 missense probably damaging 1.00
R4795:Pdgfra UTSW 5 75189311 missense probably benign
R4796:Pdgfra UTSW 5 75189311 missense probably benign
R4884:Pdgfra UTSW 5 75189312 missense probably benign 0.07
R4936:Pdgfra UTSW 5 75195026 missense probably damaging 1.00
R5625:Pdgfra UTSW 5 75189337 critical splice donor site probably null
R5666:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5670:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5714:Pdgfra UTSW 5 75186012 missense probably damaging 1.00
R5836:Pdgfra UTSW 5 75163774 missense possibly damaging 0.52
R6126:Pdgfra UTSW 5 75170529 missense probably benign 0.09
R6141:Pdgfra UTSW 5 75173396 missense probably damaging 0.98
R6297:Pdgfra UTSW 5 75173474 missense possibly damaging 0.88
R6363:Pdgfra UTSW 5 75170836 missense possibly damaging 0.91
R6376:Pdgfra UTSW 5 75166519 missense probably benign 0.02
R6485:Pdgfra UTSW 5 75175074 splice site probably null
R6612:Pdgfra UTSW 5 75167842 missense probably benign 0.01
R6641:Pdgfra UTSW 5 75162101 intron probably benign
R6954:Pdgfra UTSW 5 75173394 missense possibly damaging 0.82
R7110:Pdgfra UTSW 5 75189234 nonsense probably null
R7192:Pdgfra UTSW 5 75183106 missense probably damaging 1.00
R7294:Pdgfra UTSW 5 75181651 missense probably benign 0.05
R7347:Pdgfra UTSW 5 75183098 missense possibly damaging 0.91
R7476:Pdgfra UTSW 5 75170603 missense probably damaging 1.00
R7512:Pdgfra UTSW 5 75195014 nonsense probably null
R7609:Pdgfra UTSW 5 75166721 missense probably benign 0.10
Z1088:Pdgfra UTSW 5 75166577 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCACTCATGCTTCAACAGGAAAGG -3'
(R):5'- GTCATCCACACAGGCTTACCAAGG -3'

Sequencing Primer
(F):5'- AAAGAGTCCCGCTGCTTCAG -3'
(R):5'- AGGCTTACCAAGGCCCTC -3'
Posted On2013-04-16