Incidental Mutation 'R2873:Eif4enif1'
ID260423
Institutional Source Beutler Lab
Gene Symbol Eif4enif1
Ensembl Gene ENSMUSG00000020454
Gene Nameeukaryotic translation initiation factor 4E nuclear import factor 1
SynonymsD11Ertd166e, 2610509L04Rik, Clast4, A930019J01Rik
MMRRC Submission 040461-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.538) question?
Stock #R2873 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3202392-3244588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3242586 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 805 (P805S)
Ref Sequence ENSEMBL: ENSMUSP00000136768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020734] [ENSMUST00000110048] [ENSMUST00000110049] [ENSMUST00000120721] [ENSMUST00000135223] [ENSMUST00000179770]
Predicted Effect probably damaging
Transcript: ENSMUST00000020734
AA Change: P781S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020734
Gene: ENSMUSG00000020454
AA Change: P781S

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110048
AA Change: P781S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105675
Gene: ENSMUSG00000020454
AA Change: P781S

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110049
AA Change: P805S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105676
Gene: ENSMUSG00000020454
AA Change: P805S

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 712 2.7e-184 PFAM
low complexity region 859 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120721
AA Change: P630S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112550
Gene: ENSMUSG00000020454
AA Change: P630S

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 99 3.6e-29 PFAM
Pfam:EIF4E-T 98 327 5.1e-41 PFAM
Pfam:EIF4E-T 282 537 7.7e-30 PFAM
low complexity region 684 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127950
Predicted Effect probably benign
Transcript: ENSMUST00000135223
SMART Domains Protein: ENSMUSP00000122912
Gene: ENSMUSG00000020454

DomainStartEndE-ValueType
Pfam:EIF4E-T 1 239 1.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147534
Predicted Effect probably benign
Transcript: ENSMUST00000159304
SMART Domains Protein: ENSMUSP00000125536
Gene: ENSMUSG00000020457

DomainStartEndE-ValueType
Pfam:TGS 13 58 5.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179770
AA Change: P805S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136768
Gene: ENSMUSG00000020454
AA Change: P805S

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 710 4.3e-160 PFAM
low complexity region 859 875 N/A INTRINSIC
Meta Mutation Damage Score 0.1682 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleocytoplasmic shuttle protein for the translation initiation factor eIF4E. This shuttle protein interacts with the importin alpha-beta complex to mediate nuclear import of eIF4E. It is predominantly cytoplasmic; its own nuclear import is regulated by a nuclear localization signal and nuclear export signals. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
Acvr1 G A 2: 58,477,796 Q118* probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd40 T C 11: 94,333,945 V60A possibly damaging Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp13a2 T C 4: 141,002,983 I773T probably benign Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Ccdc162 G T 10: 41,655,099 T537N possibly damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd101 A T 3: 101,003,848 D831E probably benign Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Chek2 C A 5: 110,863,336 Y333* probably null Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Flnc A G 6: 29,447,543 D1115G probably damaging Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm5519 A C 19: 33,825,010 D151A possibly damaging Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Ndufs1 A G 1: 63,164,723 probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pms2 G A 5: 143,911,914 probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ptger4 T C 15: 5,234,805 R457G probably benign Het
Pzp A T 6: 128,485,556 probably null Het
Ralgds A G 2: 28,548,769 probably null Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc4a4 G T 5: 89,135,764 V481L probably damaging Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Slit3 G T 11: 35,544,793 E184* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tet2 C T 3: 133,486,954 G573E probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Usp9y T A Y: 1,310,502 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Eif4enif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Eif4enif1 APN 11 3221143 missense probably damaging 0.96
IGL02237:Eif4enif1 APN 11 3227876 nonsense probably null
IGL02372:Eif4enif1 APN 11 3229986 missense probably benign 0.09
PIT4283001:Eif4enif1 UTSW 11 3234464 missense probably damaging 1.00
R0079:Eif4enif1 UTSW 11 3242676 nonsense probably null
R1177:Eif4enif1 UTSW 11 3229902 missense probably damaging 1.00
R1220:Eif4enif1 UTSW 11 3239493 splice site probably benign
R1511:Eif4enif1 UTSW 11 3236278 missense probably benign 0.00
R1675:Eif4enif1 UTSW 11 3215686 missense probably benign 0.02
R1908:Eif4enif1 UTSW 11 3227455 missense probably damaging 1.00
R1940:Eif4enif1 UTSW 11 3243279 missense probably damaging 1.00
R2173:Eif4enif1 UTSW 11 3242367 splice site probably null
R2215:Eif4enif1 UTSW 11 3227476 missense probably damaging 1.00
R2517:Eif4enif1 UTSW 11 3221168 missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2871:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2871:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R3147:Eif4enif1 UTSW 11 3244003 unclassified probably null
R4195:Eif4enif1 UTSW 11 3243186 missense possibly damaging 0.89
R4196:Eif4enif1 UTSW 11 3243186 missense possibly damaging 0.89
R4708:Eif4enif1 UTSW 11 3220323 missense probably damaging 1.00
R4755:Eif4enif1 UTSW 11 3244016 missense probably damaging 1.00
R5310:Eif4enif1 UTSW 11 3242687 missense probably damaging 1.00
R5546:Eif4enif1 UTSW 11 3243989 missense probably damaging 0.99
R5816:Eif4enif1 UTSW 11 3242401 missense probably benign 0.13
R6018:Eif4enif1 UTSW 11 3242481 missense probably damaging 0.97
R6036:Eif4enif1 UTSW 11 3239420 missense probably damaging 1.00
R6036:Eif4enif1 UTSW 11 3239420 missense probably damaging 1.00
R6267:Eif4enif1 UTSW 11 3227793 missense probably damaging 1.00
R6514:Eif4enif1 UTSW 11 3240996 missense probably null 0.01
R6638:Eif4enif1 UTSW 11 3242463 missense probably damaging 0.96
R7040:Eif4enif1 UTSW 11 3234040 missense probably benign 0.33
R7232:Eif4enif1 UTSW 11 3215678 missense possibly damaging 0.75
R7385:Eif4enif1 UTSW 11 3220269 missense probably damaging 1.00
R7478:Eif4enif1 UTSW 11 3227709 nonsense probably null
R7749:Eif4enif1 UTSW 11 3242608 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCTGCTGTCATCCAATCC -3'
(R):5'- AGTGAGACTGGATTGGACTCAC -3'

Sequencing Primer
(F):5'- CAATACTGATCAAGACTCTTCTACG -3'
(R):5'- GAGACTGGATTGGACTCACTACTTAG -3'
Posted On2015-01-23