Incidental Mutation 'R2874:Tbc1d8'
ID260442
Institutional Source Beutler Lab
Gene Symbol Tbc1d8
Ensembl Gene ENSMUSG00000003134
Gene NameTBC1 domain family, member 8
SynonymsGRAM domain, AD3, HBLP1, BUB2-like protein 1
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2874 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location39371492-39478755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39405317 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 187 (F187S)
Ref Sequence ENSEMBL: ENSMUSP00000141750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054462] [ENSMUST00000192531] [ENSMUST00000193823]
Predicted Effect probably damaging
Transcript: ENSMUST00000054462
AA Change: F187S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049967
Gene: ENSMUSG00000003134
AA Change: F187S

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 3.6e-20 SMART
GRAM 285 353 2.77e-21 SMART
TBC 501 714 4.51e-54 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 991 N/A INTRINSIC
low complexity region 1030 1045 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000192531
SMART Domains Protein: ENSMUSP00000142143
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 80 98 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193823
AA Change: F187S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141750
Gene: ENSMUSG00000003134
AA Change: F187S

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 1.2e-22 SMART
GRAM 285 353 9.6e-24 SMART
TBC 501 714 2.2e-56 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 990 N/A INTRINSIC
Meta Mutation Damage Score 0.9414 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Tbc1d8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tbc1d8 APN 1 39394129 missense probably damaging 0.96
IGL01501:Tbc1d8 APN 1 39389335 missense probably damaging 1.00
IGL01548:Tbc1d8 APN 1 39381304 missense probably damaging 0.96
IGL01884:Tbc1d8 APN 1 39376445 missense probably damaging 1.00
IGL01919:Tbc1d8 APN 1 39392253 missense probably damaging 1.00
IGL02123:Tbc1d8 APN 1 39376907 missense possibly damaging 0.54
IGL02123:Tbc1d8 APN 1 39380236 missense probably damaging 0.98
IGL02135:Tbc1d8 APN 1 39402810 missense probably damaging 1.00
IGL02317:Tbc1d8 APN 1 39376904 missense probably benign 0.00
IGL02325:Tbc1d8 APN 1 39394240 missense probably damaging 0.99
IGL02607:Tbc1d8 APN 1 39379511 missense probably benign 0.05
R0533:Tbc1d8 UTSW 1 39372774 missense possibly damaging 0.82
R0604:Tbc1d8 UTSW 1 39405326 missense probably damaging 1.00
R0612:Tbc1d8 UTSW 1 39372515 missense possibly damaging 0.92
R0639:Tbc1d8 UTSW 1 39391209 missense probably benign 0.00
R0976:Tbc1d8 UTSW 1 39406801 missense probably damaging 1.00
R1051:Tbc1d8 UTSW 1 39381453 nonsense probably null
R1605:Tbc1d8 UTSW 1 39391125 missense probably benign 0.38
R1622:Tbc1d8 UTSW 1 39380236 missense probably benign 0.00
R1710:Tbc1d8 UTSW 1 39406837 missense possibly damaging 0.89
R2419:Tbc1d8 UTSW 1 39376902 missense probably damaging 1.00
R2437:Tbc1d8 UTSW 1 39405287 splice site probably null
R2862:Tbc1d8 UTSW 1 39402696 nonsense probably null
R2870:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2870:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2872:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2872:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2873:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R3759:Tbc1d8 UTSW 1 39376465 missense probably damaging 1.00
R4127:Tbc1d8 UTSW 1 39372431 missense probably benign 0.05
R4154:Tbc1d8 UTSW 1 39386135 missense probably damaging 0.99
R4613:Tbc1d8 UTSW 1 39372708 missense probably damaging 0.98
R4737:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4738:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4739:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4740:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R5189:Tbc1d8 UTSW 1 39385132 missense probably benign 0.00
R5271:Tbc1d8 UTSW 1 39373767 missense probably damaging 0.97
R5308:Tbc1d8 UTSW 1 39389409 missense probably damaging 1.00
R5393:Tbc1d8 UTSW 1 39426088 missense probably damaging 0.99
R5529:Tbc1d8 UTSW 1 39372755 missense probably benign 0.42
R5897:Tbc1d8 UTSW 1 39392109 missense possibly damaging 0.95
R6160:Tbc1d8 UTSW 1 39372403 missense probably damaging 0.98
R6408:Tbc1d8 UTSW 1 39402899 missense probably damaging 0.99
R6409:Tbc1d8 UTSW 1 39372588 missense probably benign 0.00
R6554:Tbc1d8 UTSW 1 39406822 missense probably damaging 1.00
R6841:Tbc1d8 UTSW 1 39389374 missense possibly damaging 0.68
R7282:Tbc1d8 UTSW 1 39372533 missense probably benign 0.00
R7294:Tbc1d8 UTSW 1 39406762 missense probably damaging 1.00
R7384:Tbc1d8 UTSW 1 39394098 missense probably benign 0.00
R7718:Tbc1d8 UTSW 1 39376980 missense probably benign 0.00
R7881:Tbc1d8 UTSW 1 39386023 missense probably damaging 0.98
R7918:Tbc1d8 UTSW 1 39402728 missense probably damaging 1.00
R7972:Tbc1d8 UTSW 1 39392169 missense probably damaging 1.00
R8269:Tbc1d8 UTSW 1 39426088 missense probably benign 0.00
R8352:Tbc1d8 UTSW 1 39405357 missense probably damaging 1.00
R8425:Tbc1d8 UTSW 1 39381409 missense probably damaging 1.00
R8452:Tbc1d8 UTSW 1 39405357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTGTCTGTACAAATCACGGG -3'
(R):5'- AAGTGTCTTTCTGTCCTCAGG -3'

Sequencing Primer
(F):5'- GTGTCTGTACAAATCACGGGAATATG -3'
(R):5'- TCTGATCGCAGAGGAGACC -3'
Posted On2015-01-23