Incidental Mutation 'R2874:Parp1'
ID260444
Institutional Source Beutler Lab
Gene Symbol Parp1
Ensembl Gene ENSMUSG00000026496
Gene Namepoly (ADP-ribose) polymerase family, member 1
SynonymsAdprp, 5830444G22Rik, PARP, sPARP-1, parp-1, Adprt1
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.609) question?
Stock #R2874 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180568924-180601254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180573665 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 45 (D45G)
Ref Sequence ENSEMBL: ENSMUSP00000142295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027777] [ENSMUST00000194434] [ENSMUST00000194608]
Predicted Effect probably damaging
Transcript: ENSMUST00000027777
AA Change: D45G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027777
Gene: ENSMUSG00000026496
AA Change: D45G

DomainStartEndE-ValueType
zf-PARP 12 90 4.73e-36 SMART
zf-PARP 116 200 3.99e-34 SMART
low complexity region 221 234 N/A INTRINSIC
PADR1 280 333 1.48e-28 SMART
low complexity region 359 378 N/A INTRINSIC
BRCT 388 467 9.62e-7 SMART
low complexity region 494 512 N/A INTRINSIC
WGR 553 633 2.36e-31 SMART
Pfam:PARP_reg 663 794 4e-54 PFAM
Pfam:PARP 797 1007 6.4e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000194434
AA Change: D3G

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141775
Gene: ENSMUSG00000026496
AA Change: D3G

DomainStartEndE-ValueType
Pfam:zf-PARP 1 48 3.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194608
AA Change: D45G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142295
Gene: ENSMUSG00000026496
AA Change: D45G

DomainStartEndE-ValueType
zf-PARP 12 68 2.9e-20 SMART
Meta Mutation Damage Score 0.8362 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chromatin-associated enzyme, poly(ADP-ribosyl)transferase, which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The modification is dependent on DNA and is involved in the regulation of various important cellular processes such as differentiation, proliferation, and tumor transformation and also in the regulation of the molecular events involved in the recovery of cell from DNA damage. In addition, this enzyme may be the site of mutation in Fanconi anemia, and may participate in the pathophysiology of type I diabetes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous ablation of this gene may lead to skin hyperplasia, extreme sensitivity to radiation and alkylating agents, abnormal response to xenobiotics and endogenous compounds, reduced noise-induced hearing loss, altered susceptibility to neurotoxicity,or protection against renal ischemic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Parp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Parp1 APN 1 180589580 missense probably damaging 0.99
IGL01316:Parp1 APN 1 180592935 splice site probably benign
IGL01915:Parp1 APN 1 180598342 missense probably damaging 1.00
IGL02016:Parp1 APN 1 180598951 unclassified probably null
IGL03328:Parp1 APN 1 180599590 splice site probably benign
IGL03348:Parp1 APN 1 180577707 splice site probably benign
IGL03368:Parp1 APN 1 180580622 missense probably benign 0.01
R0541:Parp1 UTSW 1 180599051 missense probably benign 0.05
R0648:Parp1 UTSW 1 180600440 splice site probably benign
R1326:Parp1 UTSW 1 180600458 missense probably damaging 1.00
R1421:Parp1 UTSW 1 180600088 splice site probably benign
R1438:Parp1 UTSW 1 180591242 missense probably benign 0.08
R1781:Parp1 UTSW 1 180588013 missense probably benign 0.04
R1800:Parp1 UTSW 1 180600526 intron probably null
R1900:Parp1 UTSW 1 180597339 missense probably damaging 0.98
R1903:Parp1 UTSW 1 180588670 missense probably damaging 1.00
R2869:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2869:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2873:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R4342:Parp1 UTSW 1 180587329 missense probably benign 0.00
R4510:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4511:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4529:Parp1 UTSW 1 180591312 missense probably damaging 1.00
R4740:Parp1 UTSW 1 180589468 missense probably damaging 0.99
R4876:Parp1 UTSW 1 180569035 start codon destroyed probably null 1.00
R6666:Parp1 UTSW 1 180585951 missense probably benign
R6766:Parp1 UTSW 1 180598362 missense probably damaging 1.00
R6918:Parp1 UTSW 1 180588670 missense possibly damaging 0.46
R6974:Parp1 UTSW 1 180589506 nonsense probably null
R6996:Parp1 UTSW 1 180587371 missense possibly damaging 0.46
R7034:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7036:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7068:Parp1 UTSW 1 180588668 missense probably damaging 1.00
R7156:Parp1 UTSW 1 180599064 missense possibly damaging 0.91
R7326:Parp1 UTSW 1 180569100 missense possibly damaging 0.94
R7603:Parp1 UTSW 1 180600212 critical splice donor site probably null
R7733:Parp1 UTSW 1 180600212 critical splice donor site probably null
R7772:Parp1 UTSW 1 180589398 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TACCCAGGATGAGAAGCCAG -3'
(R):5'- TCCATGCAAGCTTAAAGTCTTCC -3'

Sequencing Primer
(F):5'- AGAAGCTGTTTCTCATCCATTTG -3'
(R):5'- AGAGAGAGCGCTTGAACCCC -3'
Posted On2015-01-23