Incidental Mutation 'R2874:Kpna7'
ID260453
Institutional Source Beutler Lab
Gene Symbol Kpna7
Ensembl Gene ENSMUSG00000038770
Gene Namekaryopherin alpha 7 (importin alpha 8)
SynonymsLOC381686
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R2874 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144983519-145084030 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144993935 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 367 (T367A)
Ref Sequence ENSEMBL: ENSMUSP00000106301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110672] [ENSMUST00000110673] [ENSMUST00000116454]
Predicted Effect probably benign
Transcript: ENSMUST00000110672
AA Change: T346A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000106300
Gene: ENSMUSG00000038770
AA Change: T346A

DomainStartEndE-ValueType
Pfam:IBB 2 91 1.7e-14 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 6.18e-10 SMART
ARM 185 226 1.78e-1 SMART
ARM 229 268 4.28e-4 SMART
ARM 270 310 1.19e-2 SMART
ARM 312 352 5.27e-4 SMART
ARM 354 393 2.85e0 SMART
ARM 396 436 8.17e-1 SMART
low complexity region 486 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110673
AA Change: T367A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106301
Gene: ENSMUSG00000038770
AA Change: T367A

DomainStartEndE-ValueType
Pfam:IBB 6 90 2.7e-19 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 3.31e-10 SMART
ARM 206 247 1.78e-1 SMART
ARM 250 289 4.28e-4 SMART
ARM 291 331 1.19e-2 SMART
ARM 333 373 5.27e-4 SMART
ARM 375 414 2.85e0 SMART
ARM 417 457 8.17e-1 SMART
Pfam:Arm_3 466 517 8.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116454
AA Change: T346A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000112155
Gene: ENSMUSG00000038770
AA Change: T346A

DomainStartEndE-ValueType
Pfam:IBB 2 91 1.7e-14 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 6.18e-10 SMART
ARM 185 226 1.78e-1 SMART
ARM 229 268 4.28e-4 SMART
ARM 270 310 1.19e-2 SMART
ARM 312 352 5.27e-4 SMART
ARM 354 393 2.85e0 SMART
ARM 396 436 8.17e-1 SMART
low complexity region 486 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142866
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import, but exhibits different nuclear localization signal binding specificity compared to other members of the family. A pseudogene of this gene has been defined on chromosome 5. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display smaller litter sizes with preferential loss of females and accelerated cell cycles post fertilization resulting in loss of embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Kpna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Kpna7 APN 5 145007246 missense probably damaging 1.00
IGL01505:Kpna7 APN 5 144992851 missense probably damaging 1.00
IGL02009:Kpna7 APN 5 144994078 critical splice acceptor site probably null
IGL02365:Kpna7 APN 5 144985733 missense possibly damaging 0.49
IGL02947:Kpna7 APN 5 144994074 missense probably damaging 1.00
IGL03195:Kpna7 APN 5 144997037 missense probably damaging 1.00
IGL03236:Kpna7 APN 5 144985694 missense unknown
IGL03333:Kpna7 APN 5 145005955 missense possibly damaging 0.48
PIT4515001:Kpna7 UTSW 5 145005052 missense probably benign 0.17
R0027:Kpna7 UTSW 5 144989697 missense probably damaging 0.99
R0421:Kpna7 UTSW 5 144989741 missense possibly damaging 0.82
R0463:Kpna7 UTSW 5 145007994 missense possibly damaging 0.66
R2229:Kpna7 UTSW 5 144989697 missense probably damaging 0.99
R2871:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R2871:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R2873:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R4079:Kpna7 UTSW 5 145005927 missense possibly damaging 0.82
R5841:Kpna7 UTSW 5 144993956 missense possibly damaging 0.73
R5888:Kpna7 UTSW 5 144989795 missense probably damaging 0.98
R6188:Kpna7 UTSW 5 144992844 missense probably damaging 1.00
R7163:Kpna7 UTSW 5 145002396 missense unknown
R7502:Kpna7 UTSW 5 145005921 missense probably benign 0.07
R7727:Kpna7 UTSW 5 145005045 missense probably benign 0.19
R8921:Kpna7 UTSW 5 145005030
X0021:Kpna7 UTSW 5 145007233 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCCTGACTCCCATCTGAGATTTG -3'
(R):5'- GACAGGTTTGCAATCCTTAGACAC -3'

Sequencing Primer
(F):5'- CTAGAGCTCAGACTGGCTTTACG -3'
(R):5'- AGGTTTGCAATCCTTAGACACCTTTC -3'
Posted On2015-01-23