Mutagenetix > Incidental Mutation

Incidental Mutation 'R2874:Vmn2r68'

260460

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

Vmn2r68-ps, EG620697

MMRRC Submission

040462-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R2874 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85221518-85237704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 85233626 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 306 (M306R)

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

probably benign
Transcript: ENSMUST00000061074
AA Change: M306R

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: M306R

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (57/57)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	T	A	13: 58,382,570	I209F	probably damaging	Het
4931428F04Rik	A	G	8: 105,282,032	M451T	possibly damaging	Het
A930029G22Rik	T	A	17: 69,418,111		noncoding transcript	Het
Ankrd42	T	C	7: 92,605,358	K348E	possibly damaging	Het
Arhgef10	T	C	8: 14,975,093		probably null	Het
Arhgef10	A	G	8: 14,975,666	I459V	probably benign	Het
Cd6	A	G	19: 10,794,626	I307T	possibly damaging	Het
Cebpz	A	T	17: 78,932,103		probably benign	Het
Clcn4	A	G	7: 7,290,521	I412T	probably benign	Het
Clstn3	T	A	6: 124,438,335	D690V	probably damaging	Het
Col12a1	A	T	9: 79,699,549	F531I	probably damaging	Het
Dhx57	A	T	17: 80,251,376	D1051E	probably benign	Het
Ext2	A	G	2: 93,739,686	V460A	possibly damaging	Het
Frmpd4	A	T	X: 167,477,247	D1166E	probably benign	Het
Fscb	T	C	12: 64,473,436	K419E	probably benign	Het
Ggct	G	T	6: 54,992,774	A21D	probably damaging	Het
Gm10717	A	G	9: 3,025,532	Y39C	probably benign	Het
Gm813	A	T	16: 58,613,979	I125K	probably benign	Het
Grid2ip	C	A	5: 143,357,929	Q127K	probably benign	Het
Ighv2-2	G	A	12: 113,588,498	T40I	possibly damaging	Het
Itpr2	T	C	6: 146,426,498	K79R	possibly damaging	Het
Klf8	A	T	X: 153,382,682	E82D	probably damaging	Het
Kpna7	T	C	5: 144,993,935	T367A	probably benign	Het
Lactbl1	G	A	4: 136,626,786	C37Y	probably damaging	Het
Lrp1b	A	G	2: 40,851,693	L3188P	probably damaging	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Noc4l	A	G	5: 110,649,103	V465A	probably benign	Het
Notch1	A	G	2: 26,460,235	C2298R	possibly damaging	Het
Olfr419	T	C	1: 174,250,526	S134G	probably benign	Het
Parp1	A	G	1: 180,573,665	D45G	probably damaging	Het
Plxna3	T	A	X: 74,339,396		probably benign	Het
Prdx4	A	G	X: 155,340,464	V15A	probably benign	Het
Prps1	C	T	X: 140,471,994		probably benign	Het
Psmb8	T	C	17: 34,200,170	I146T	probably damaging	Het
Ralgds	A	G	2: 28,548,769		probably null	Het
Rasl12	A	G	9: 65,408,323	N83S	probably benign	Het
Rnf6	T	C	5: 146,210,405	Y601C	probably benign	Het
Rreb1	T	C	13: 37,916,508	I205T	probably benign	Het
Sgk2	A	G	2: 162,994,529		probably benign	Het
Spsb4	G	T	9: 96,996,018	T84K	probably damaging	Het
St5	A	T	7: 109,557,430	Y38N	probably benign	Het
St7	C	T	6: 17,819,277	P60L	probably damaging	Het
Stx3	A	T	19: 11,789,574	V91D	probably damaging	Het
Tbc1d8	A	G	1: 39,405,317	F187S	probably damaging	Het
Tep1	A	G	14: 50,850,650	I85T	possibly damaging	Het
Trpa1	A	G	1: 14,887,620	C705R	probably damaging	Het
Vwa7	G	A	17: 35,021,242	M395I	probably damaging	Het
Zfp53	A	T	17: 21,508,078	E124D	probably benign	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	85237611	missense	probably benign
IGL01477:Vmn2r68	APN	7	85233483	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	85222260	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	85222117	missense	probably benign
IGL01999:Vmn2r68	APN	7	85222231	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	85221739	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	85221945	nonsense	probably null
IGL02827:Vmn2r68	APN	7	85237592	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	85233387	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	85234441	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	85222240	nonsense	probably null
IGL03166:Vmn2r68	APN	7	85222123	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	85221764	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	85233755	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0280:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0281:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0348:Vmn2r68	UTSW	7	85221676	missense	possibly damaging	0.50
R0390:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0390:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0722:Vmn2r68	UTSW	7	85221586	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	85237504	splice site	probably null
R1136:Vmn2r68	UTSW	7	85222341	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	85232492	missense	probably damaging	0.96
R1614:Vmn2r68	UTSW	7	85221738	missense	possibly damaging	0.93
R1682:Vmn2r68	UTSW	7	85233366	missense	possibly damaging	0.68
R1837:Vmn2r68	UTSW	7	85233678	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	85234659	nonsense	probably null
R1908:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	85233894	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	85221915	missense	probably benign	0.01
R2178:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2185:Vmn2r68	UTSW	7	85233693	nonsense	probably null
R2188:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2282:Vmn2r68	UTSW	7	85221651	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	85234595	missense	probably benign
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	85237667	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R3978:Vmn2r68	UTSW	7	85232462	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4421:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4478:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4479:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4495:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4628:Vmn2r68	UTSW	7	85234465	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	85221535	missense	probably benign
R4654:Vmn2r68	UTSW	7	85233561	nonsense	probably null
R4793:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	85232414	missense	probably benign
R5021:Vmn2r68	UTSW	7	85233734	missense	possibly damaging	0.62
R5082:Vmn2r68	UTSW	7	85233868	missense	probably benign	0.12
R5177:Vmn2r68	UTSW	7	85221991	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	85221877	missense	probably damaging	1.00
R5514:Vmn2r68	UTSW	7	85237559	missense	possibly damaging	0.92
R5521:Vmn2r68	UTSW	7	85233718	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	85222075	missense	probably damaging	1.00
R5664:Vmn2r68	UTSW	7	85233770	missense	probably benign	0.02
R5829:Vmn2r68	UTSW	7	85237604	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	85222245	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	85233840	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	85221765	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	85233707	missense	probably benign
R6699:Vmn2r68	UTSW	7	85232375	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	85222252	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	85233834	missense	probably benign
R7374:Vmn2r68	UTSW	7	85232399	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	85232379	missense	probably damaging	1.00
R7605:Vmn2r68	UTSW	7	85233908	missense	probably benign	0.01
R7892:Vmn2r68	UTSW	7	85234514	missense	probably benign
R7979:Vmn2r68	UTSW	7	85234417	critical splice donor site	probably null
R8177:Vmn2r68	UTSW	7	85222214	nonsense	probably null
R8349:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	85221900	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	85237514	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	85222113	missense	possibly damaging	0.68
R9056:Vmn2r68	UTSW	7	85222212	missense	possibly damaging	0.71
R9342:Vmn2r68	UTSW	7	85233785	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	85233549	missense	possibly damaging	0.54
V7581:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
Z1176:Vmn2r68	UTSW	7	85221733	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	85222081	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	85222099	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GCCATTCCAAGTGGTGTCATG -3'
(R):5'- GGCCCATAAAGAGTTTCAAAGG -3'

Sequencing Primer
(F):5'- CCAAGTGGTGTCATGAATAACC -3'
(R):5'- GAGACTACACCTCTCCCATA -3'

Posted On

2015-01-23