Incidental Mutation 'R2874:Fscb'
ID260472
Institutional Source Beutler Lab
Gene Symbol Fscb
Ensembl Gene ENSMUSG00000043060
Gene Namefibrous sheath CABYR binding protein
SynonymsEG623046
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2874 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location64471330-64474690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64473436 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 419 (K419E)
Ref Sequence ENSEMBL: ENSMUSP00000051554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059833]
Predicted Effect probably benign
Transcript: ENSMUST00000059833
AA Change: K419E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000051554
Gene: ENSMUSG00000043060
AA Change: K419E

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
internal_repeat_1 295 465 2.4e-7 PROSPERO
low complexity region 483 501 N/A INTRINSIC
low complexity region 510 547 N/A INTRINSIC
low complexity region 558 595 N/A INTRINSIC
low complexity region 599 622 N/A INTRINSIC
low complexity region 641 661 N/A INTRINSIC
low complexity region 673 708 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
internal_repeat_1 736 895 2.4e-7 PROSPERO
internal_repeat_2 751 871 6.17e-6 PROSPERO
low complexity region 899 916 N/A INTRINSIC
internal_repeat_2 919 1046 6.17e-6 PROSPERO
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Fscb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Fscb APN 12 64473381 missense possibly damaging 0.46
IGL01099:Fscb APN 12 64472101 missense unknown
IGL01394:Fscb APN 12 64473804 missense possibly damaging 0.83
IGL02570:Fscb APN 12 64472178 missense unknown
IGL02974:Fscb APN 12 64471525 missense unknown
IGL03150:Fscb APN 12 64472430 missense unknown
IGL03407:Fscb APN 12 64473495 missense probably damaging 0.96
BB007:Fscb UTSW 12 64472563 missense unknown
BB017:Fscb UTSW 12 64472563 missense unknown
FR4548:Fscb UTSW 12 64472563 missense unknown
FR4548:Fscb UTSW 12 64472565 missense unknown
R0056:Fscb UTSW 12 64474247 missense possibly damaging 0.66
R0490:Fscb UTSW 12 64472887 missense unknown
R0492:Fscb UTSW 12 64473518 missense possibly damaging 0.46
R0702:Fscb UTSW 12 64472001 missense unknown
R1017:Fscb UTSW 12 64473468 missense probably benign 0.07
R1672:Fscb UTSW 12 64471518 missense unknown
R1737:Fscb UTSW 12 64474581 missense possibly damaging 0.83
R1795:Fscb UTSW 12 64474401 missense probably damaging 0.99
R1969:Fscb UTSW 12 64473234 missense unknown
R1984:Fscb UTSW 12 64474683 missense unknown
R2164:Fscb UTSW 12 64473793 missense probably damaging 0.96
R2213:Fscb UTSW 12 64474116 missense possibly damaging 0.84
R2878:Fscb UTSW 12 64472574 missense unknown
R3873:Fscb UTSW 12 64473132 missense unknown
R4734:Fscb UTSW 12 64474470 missense possibly damaging 0.82
R4773:Fscb UTSW 12 64473690 missense probably damaging 1.00
R4940:Fscb UTSW 12 64473814 missense probably benign 0.03
R4981:Fscb UTSW 12 64473619 missense possibly damaging 0.46
R5105:Fscb UTSW 12 64473336 missense possibly damaging 0.82
R5845:Fscb UTSW 12 64472784 missense unknown
R6049:Fscb UTSW 12 64474320 missense possibly damaging 0.66
R6743:Fscb UTSW 12 64471573 missense unknown
R7026:Fscb UTSW 12 64471617 missense unknown
R7285:Fscb UTSW 12 64471549 missense unknown
R7372:Fscb UTSW 12 64471824 missense unknown
R7400:Fscb UTSW 12 64471617 missense unknown
R7563:Fscb UTSW 12 64473285 missense possibly damaging 0.82
R7748:Fscb UTSW 12 64474407 missense probably benign 0.04
R7759:Fscb UTSW 12 64474092 missense probably benign 0.03
R7930:Fscb UTSW 12 64472563 missense unknown
R8026:Fscb UTSW 12 64474275 missense probably benign 0.12
R8070:Fscb UTSW 12 64474608 missense probably benign 0.04
R8081:Fscb UTSW 12 64472028 missense unknown
R8331:Fscb UTSW 12 64473468 missense probably benign 0.07
R8405:Fscb UTSW 12 64473504 missense possibly damaging 0.82
R8788:Fscb UTSW 12 64471621 missense unknown
R8833:Fscb UTSW 12 64473223 missense unknown
RF011:Fscb UTSW 12 64472994 small deletion probably benign
RF019:Fscb UTSW 12 64472596 small insertion probably benign
RF038:Fscb UTSW 12 64472569 small insertion probably benign
Z1176:Fscb UTSW 12 64472930 missense unknown
Z1177:Fscb UTSW 12 64472628 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGCAGTCAGGTCTTCTACAG -3'
(R):5'- ATCTGGATCCATTCTCAGAAGAGG -3'

Sequencing Primer
(F):5'- AGTCAGGTCTTCTACAGTTCCCTG -3'
(R):5'- ATCCATTCTCAGAAGAGGTGCTTGAG -3'
Posted On2015-01-23