Incidental Mutation 'R2874:Gm813'
ID260476
Institutional Source Beutler Lab
Gene Symbol Gm813
Ensembl Gene ENSMUSG00000075002
Gene Namepredicted gene 813
SynonymsLOC385656, LOC328695
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2874 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58613675-58616978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58613979 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 125 (I125K)
Ref Sequence ENSEMBL: ENSMUSP00000097255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099663]
Predicted Effect probably benign
Transcript: ENSMUST00000099663
AA Change: I125K

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097255
Gene: ENSMUSG00000075002
AA Change: I125K

DomainStartEndE-ValueType
Pfam:Ferritin 14 152 7.4e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Gm813
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02701:Gm813 APN 16 58615807 missense probably benign 0.00
IGL02839:Gm813 APN 16 58615847 missense probably damaging 1.00
IGL03275:Gm813 APN 16 58615756 missense probably damaging 1.00
R0946:Gm813 UTSW 16 58614712 missense probably damaging 1.00
R1323:Gm813 UTSW 16 58616915 missense possibly damaging 0.65
R1323:Gm813 UTSW 16 58616915 missense possibly damaging 0.65
R1548:Gm813 UTSW 16 58615839 missense probably benign 0.06
R2382:Gm813 UTSW 16 58615876 splice site probably null
R2871:Gm813 UTSW 16 58613979 missense probably benign 0.39
R2871:Gm813 UTSW 16 58613979 missense probably benign 0.39
R2873:Gm813 UTSW 16 58613979 missense probably benign 0.39
R4690:Gm813 UTSW 16 58613970 missense probably benign 0.00
R5097:Gm813 UTSW 16 58613864 missense probably benign 0.15
R5822:Gm813 UTSW 16 58615712 critical splice donor site probably null
R6234:Gm813 UTSW 16 58614671 missense probably benign 0.01
R6382:Gm813 UTSW 16 58613910 missense possibly damaging 0.73
R7170:Gm813 UTSW 16 58615728 nonsense probably null
R8119:Gm813 UTSW 16 58616848 missense probably benign 0.00
RF016:Gm813 UTSW 16 58616867 missense probably damaging 1.00
X0026:Gm813 UTSW 16 58613959 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTTGCTGATCTAGGGCTTGC -3'
(R):5'- ATGCATATGAATCGCCTGGTC -3'

Sequencing Primer
(F):5'- GCAATAGAAAGGCTTGTCCTACTCG -3'
(R):5'- CATATGAATCGCCTGGTCTCTTGG -3'
Posted On2015-01-23