Incidental Mutation 'R2874:Zfp53'
ID260477
Institutional Source Beutler Lab
Gene Symbol Zfp53
Ensembl Gene ENSMUSG00000057409
Gene Namezinc finger protein 53
SynonymsZfp-53, KRAZ1, Zfp118, zfas8, D030067O06Rik
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R2874 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21491256-21509764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21508078 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 124 (E124D)
Ref Sequence ENSEMBL: ENSMUSP00000075960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076664]
Predicted Effect probably benign
Transcript: ENSMUST00000076664
AA Change: E124D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075960
Gene: ENSMUSG00000057409
AA Change: E124D

DomainStartEndE-ValueType
KRAB 54 114 6.06e-23 SMART
ZnF_C2H2 226 248 1.18e-2 SMART
ZnF_C2H2 254 276 1.28e-3 SMART
ZnF_C2H2 282 304 2.65e-5 SMART
ZnF_C2H2 310 332 9.58e-3 SMART
ZnF_C2H2 338 360 2.86e-1 SMART
ZnF_C2H2 366 388 4.24e-4 SMART
ZnF_C2H2 394 416 4.87e-4 SMART
ZnF_C2H2 422 444 3.69e-4 SMART
ZnF_C2H2 450 472 6.23e-2 SMART
ZnF_C2H2 478 500 7.26e-3 SMART
ZnF_C2H2 506 528 1.72e-4 SMART
ZnF_C2H2 534 556 5.14e-3 SMART
ZnF_C2H2 562 584 9.08e-4 SMART
ZnF_C2H2 590 612 3.89e-3 SMART
ZnF_C2H2 618 640 4.87e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus results in pigmentation abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Other mutations in Zfp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zfp53 APN 17 21508338 missense probably benign
IGL00862:Zfp53 APN 17 21509098 missense probably benign 0.04
IGL01651:Zfp53 APN 17 21508086 missense probably benign 0.19
IGL02183:Zfp53 APN 17 21500250 missense possibly damaging 0.51
R0063:Zfp53 UTSW 17 21508105 missense probably benign 0.19
R0449:Zfp53 UTSW 17 21508833 missense probably benign 0.17
R0514:Zfp53 UTSW 17 21509009 missense probably damaging 1.00
R0755:Zfp53 UTSW 17 21508577 missense probably damaging 1.00
R1661:Zfp53 UTSW 17 21509504 missense probably damaging 1.00
R1665:Zfp53 UTSW 17 21509504 missense probably damaging 1.00
R1693:Zfp53 UTSW 17 21509622 missense possibly damaging 0.60
R2113:Zfp53 UTSW 17 21508451 missense probably benign 0.19
R2869:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2869:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2870:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2870:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2871:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2871:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2873:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2908:Zfp53 UTSW 17 21508474 nonsense probably null
R3873:Zfp53 UTSW 17 21508631 missense probably damaging 0.98
R4499:Zfp53 UTSW 17 21509235 missense probably damaging 0.96
R4806:Zfp53 UTSW 17 21505001 missense possibly damaging 0.91
R5007:Zfp53 UTSW 17 21509510 missense probably benign 0.15
R6261:Zfp53 UTSW 17 21508713 missense possibly damaging 0.90
R6329:Zfp53 UTSW 17 21508110 missense probably benign 0.01
R6452:Zfp53 UTSW 17 21509613 missense probably damaging 1.00
R6899:Zfp53 UTSW 17 21508445 missense possibly damaging 0.62
R7033:Zfp53 UTSW 17 21500246 missense probably benign 0.05
R7250:Zfp53 UTSW 17 21509578 missense probably damaging 1.00
R8068:Zfp53 UTSW 17 21509012 missense probably benign 0.06
R8491:Zfp53 UTSW 17 21509359 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGGGTCAGCTACTGGGAGATC -3'
(R):5'- TGTTTGCAGCATAGAGTCTCTG -3'

Sequencing Primer
(F):5'- GTCAGCTACTGGGAGATCTATTC -3'
(R):5'- GCAGCATAGAGTCTCTGATTTTC -3'
Posted On2015-01-23