Incidental Mutation 'R2874:Psmb8'
ID260479
Institutional Source Beutler Lab
Gene Symbol Psmb8
Ensembl Gene ENSMUSG00000024338
Gene Nameproteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7)
SynonymsLmp7, Lmp-7
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2874 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34197721-34201454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34200170 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 146 (I146T)
Ref Sequence ENSEMBL: ENSMUSP00000134664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025196] [ENSMUST00000025197] [ENSMUST00000041633] [ENSMUST00000131105] [ENSMUST00000138491] [ENSMUST00000170086] [ENSMUST00000173441]
Predicted Effect probably damaging
Transcript: ENSMUST00000025196
AA Change: I146T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025196
Gene: ENSMUSG00000024338
AA Change: I146T

DomainStartEndE-ValueType
Pfam:Proteasome 69 251 1.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025197
SMART Domains Protein: ENSMUSP00000025197
Gene: ENSMUSG00000024339

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
Pfam:ABC_membrane 151 419 1.8e-62 PFAM
AAA 494 678 2.58e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041633
SMART Domains Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 420 9.1e-55 PFAM
AAA 478 666 2.21e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127543
Predicted Effect probably benign
Transcript: ENSMUST00000131105
SMART Domains Protein: ENSMUSP00000118700
Gene: ENSMUSG00000024339

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168351
Predicted Effect probably benign
Transcript: ENSMUST00000170086
SMART Domains Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 434 5.8e-70 PFAM
AAA 506 694 2.21e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172960
Predicted Effect probably damaging
Transcript: ENSMUST00000173441
AA Change: I146T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134664
Gene: ENSMUSG00000024338
AA Change: I146T

DomainStartEndE-ValueType
Pfam:Proteasome 69 248 6.3e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173770
Meta Mutation Damage Score 0.7752 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 3 (proteasome beta 5 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. Two alternative transcripts encoding two isoforms have been identified; both isoforms are processed to yield the same mature subunit. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However they have a reduced ability to process MHC class I restricted antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Psmb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Psmb8 APN 17 34200729 missense probably damaging 0.97
IGL01153:Psmb8 APN 17 34201241 missense possibly damaging 0.82
IGL01307:Psmb8 APN 17 34199236 missense probably benign
IGL01394:Psmb8 APN 17 34200729 missense probably damaging 1.00
IGL01821:Psmb8 APN 17 34198543 missense probably benign
IGL01936:Psmb8 APN 17 34200194 missense probably damaging 1.00
IGL02118:Psmb8 APN 17 34201224 missense probably damaging 0.98
IGL02708:Psmb8 APN 17 34201243 missense probably benign 0.00
IGL02739:Psmb8 APN 17 34200754 nonsense probably null
R1952:Psmb8 UTSW 17 34200910 missense probably damaging 1.00
R2869:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2869:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2870:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2870:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2871:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2871:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2873:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R5632:Psmb8 UTSW 17 34201240 missense probably benign
R6395:Psmb8 UTSW 17 34199291 missense possibly damaging 0.86
R6993:Psmb8 UTSW 17 34199643 missense probably damaging 1.00
R7645:Psmb8 UTSW 17 34200212 missense possibly damaging 0.76
R7672:Psmb8 UTSW 17 34198430 missense probably benign 0.06
R8804:Psmb8 UTSW 17 34200251 missense probably damaging 1.00
Z1176:Psmb8 UTSW 17 34200856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGGATCAGAGATTTTAAATTCCC -3'
(R):5'- ATCAAAACCTGGATCAAGCATGG -3'

Sequencing Primer
(F):5'- ACTCTTATGTCCCGTCCCACAAG -3'
(R):5'- AGATCATGCTGCCCATG -3'
Posted On2015-01-23