Incidental Mutation 'R2874:Vwa7'
ID260480
Institutional Source Beutler Lab
Gene Symbol Vwa7
Ensembl Gene ENSMUSG00000007030
Gene Namevon Willebrand factor A domain containing 7
SynonymsD17H6S56E-3, G7c
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2874 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35016579-35026741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35021242 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 395 (M395I)
Ref Sequence ENSEMBL: ENSMUSP00000133418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007245] [ENSMUST00000040151] [ENSMUST00000087315] [ENSMUST00000172499] [ENSMUST00000174037]
Predicted Effect probably damaging
Transcript: ENSMUST00000007245
AA Change: M395I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007245
Gene: ENSMUSG00000007030
AA Change: M395I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 499 2.59e0 SMART
low complexity region 683 701 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 864 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040151
SMART Domains Protein: ENSMUSP00000047448
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
Pfam:Suppressor_APC 35 114 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087315
SMART Domains Protein: ENSMUSP00000084572
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
Pfam:GST_N 2 81 5.7e-16 PFAM
Pfam:GST_C 107 198 7.3e-13 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 2e-197 PFAM
Pfam:tRNA-synt_1g 336 496 6e-6 PFAM
Pfam:tRNA-synt_1_2 555 623 1.9e-11 PFAM
Pfam:Anticodon_1 983 1138 2.6e-34 PFAM
low complexity region 1153 1174 N/A INTRINSIC
low complexity region 1207 1225 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172499
AA Change: M395I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133418
Gene: ENSMUSG00000007030
AA Change: M395I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 478 7.28e0 SMART
low complexity region 662 680 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173211
Predicted Effect probably benign
Transcript: ENSMUST00000174037
SMART Domains Protein: ENSMUSP00000133881
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
low complexity region 55 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
Meta Mutation Damage Score 0.4728 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Vwa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Vwa7 APN 17 35024942 missense probably damaging 1.00
IGL01736:Vwa7 APN 17 35019851 missense probably damaging 1.00
IGL01868:Vwa7 APN 17 35021259 missense probably null 0.96
IGL01920:Vwa7 APN 17 35024603 missense probably benign 0.01
IGL02227:Vwa7 APN 17 35020084 missense probably damaging 1.00
IGL02947:Vwa7 APN 17 35023500 splice site probably null
IGL03259:Vwa7 APN 17 35020026 splice site probably null
IGL03263:Vwa7 APN 17 35021599 missense probably benign 0.16
R0008:Vwa7 UTSW 17 35019805 missense probably benign 0.33
R0057:Vwa7 UTSW 17 35024547 missense possibly damaging 0.85
R0057:Vwa7 UTSW 17 35024547 missense possibly damaging 0.85
R0418:Vwa7 UTSW 17 35017957 missense possibly damaging 0.57
R0538:Vwa7 UTSW 17 35022651 missense probably damaging 1.00
R1121:Vwa7 UTSW 17 35017794 missense probably damaging 1.00
R1659:Vwa7 UTSW 17 35019071 missense probably benign 0.04
R1766:Vwa7 UTSW 17 35023943 critical splice donor site probably null
R1777:Vwa7 UTSW 17 35024948 missense probably damaging 1.00
R1793:Vwa7 UTSW 17 35024412 nonsense probably null
R1874:Vwa7 UTSW 17 35017112 missense probably benign 0.00
R2139:Vwa7 UTSW 17 35023430 missense probably benign 0.00
R2248:Vwa7 UTSW 17 35019043 missense probably benign 0.04
R2290:Vwa7 UTSW 17 35017211 missense probably damaging 1.00
R2869:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2869:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2870:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2870:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2871:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2871:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2873:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R3038:Vwa7 UTSW 17 35022661 missense probably damaging 1.00
R3792:Vwa7 UTSW 17 35025159 splice site probably null
R3970:Vwa7 UTSW 17 35017708 missense probably damaging 1.00
R4612:Vwa7 UTSW 17 35023450 missense probably damaging 0.96
R5013:Vwa7 UTSW 17 35022733 missense probably damaging 1.00
R5068:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5069:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5070:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5137:Vwa7 UTSW 17 35017846 missense probably damaging 1.00
R5384:Vwa7 UTSW 17 35024926 splice site probably null
R6170:Vwa7 UTSW 17 35021210 missense possibly damaging 0.56
R6229:Vwa7 UTSW 17 35024265 missense probably benign 0.00
R6249:Vwa7 UTSW 17 35023389 missense probably benign 0.00
R6401:Vwa7 UTSW 17 35017310 splice site probably null
R6429:Vwa7 UTSW 17 35024199 missense probably benign 0.32
R6678:Vwa7 UTSW 17 35019800 missense probably damaging 1.00
R6793:Vwa7 UTSW 17 35024891 missense probably benign 0.06
R6966:Vwa7 UTSW 17 35017096 missense probably benign
R7492:Vwa7 UTSW 17 35019044 missense possibly damaging 0.86
R7903:Vwa7 UTSW 17 35017787 missense probably damaging 1.00
R7922:Vwa7 UTSW 17 35024433 missense possibly damaging 0.81
R8191:Vwa7 UTSW 17 35019736 missense probably damaging 0.96
R8728:Vwa7 UTSW 17 35017157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCTCAGGTGAGTTCTATCC -3'
(R):5'- ACCCTGGAAGGAAGCTGATG -3'

Sequencing Primer
(F):5'- GTTCAGCAGCTAAGAGTACTTGC -3'
(R):5'- CTGGAAGGAAGCTGATGGAACC -3'
Posted On2015-01-23