Incidental Mutation 'R2874:Cd6'
ID260486
Institutional Source Beutler Lab
Gene Symbol Cd6
Ensembl Gene ENSMUSG00000024670
Gene NameCD6 antigen
Synonyms
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2874 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10789341-10830058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10794626 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 307 (I307T)
Ref Sequence ENSEMBL: ENSMUSP00000134639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039043] [ENSMUST00000080292] [ENSMUST00000174176]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000025572
Predicted Effect probably benign
Transcript: ENSMUST00000039043
AA Change: I408T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000046861
Gene: ENSMUSG00000024670
AA Change: I408T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SR 45 155 7.33e-9 SMART
SR 160 259 8.68e-52 SMART
SR 264 360 3.51e-29 SMART
low complexity region 383 394 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 611 623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080292
AA Change: I408T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000079172
Gene: ENSMUSG00000024670
AA Change: I408T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SR 45 155 7.33e-9 SMART
SR 160 259 8.68e-52 SMART
SR 264 360 3.51e-29 SMART
low complexity region 383 394 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173613
Predicted Effect possibly damaging
Transcript: ENSMUST00000174176
AA Change: I307T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134639
Gene: ENSMUSG00000024670
AA Change: I307T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SR 45 155 7.33e-9 SMART
SR 160 259 8.68e-52 SMART
low complexity region 282 293 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
Meta Mutation Damage Score 0.4887 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein found on the outer membrane of T-lymphocytes as well as some other immune cells. The encoded protein contains three scavenger receptor cysteine-rich (SRCR) domains and a binding site for an activated leukocyte cell adhesion molecule. The gene product is important for continuation of T cell activation. This gene may be associated with susceptibility to multiple sclerosis (PMID: 19525953, 21849685). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to insteinal ischemia/reperfusion induced injury due to reduced IgM-producing B1a cell self-renewal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Cd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Cd6 APN 19 10796394 splice site probably benign
IGL01326:Cd6 APN 19 10791102 missense probably benign 0.09
IGL01406:Cd6 APN 19 10791137 missense possibly damaging 0.77
IGL01885:Cd6 APN 19 10799237 missense probably benign
IGL02268:Cd6 APN 19 10796388 missense probably benign 0.03
IGL03100:Cd6 APN 19 10792939 missense probably benign 0.34
digression UTSW 19 10798358 nonsense probably null
R1856:Cd6 UTSW 19 10798602 missense probably damaging 0.98
R2419:Cd6 UTSW 19 10792852 missense probably damaging 1.00
R2869:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2869:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2870:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2870:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2936:Cd6 UTSW 19 10796322 splice site probably null
R4124:Cd6 UTSW 19 10790608 missense probably damaging 1.00
R4748:Cd6 UTSW 19 10794225 nonsense probably null
R6665:Cd6 UTSW 19 10791003 missense probably benign 0.03
R6720:Cd6 UTSW 19 10794609 missense probably benign 0.09
R7793:Cd6 UTSW 19 10798358 nonsense probably null
R8122:Cd6 UTSW 19 10792867 missense probably damaging 1.00
Z1177:Cd6 UTSW 19 10791445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATGCTGGGAAAATCTTTC -3'
(R):5'- AAGTGGATCAGTTCATGGGTAG -3'

Sequencing Primer
(F):5'- TCCCACCATCAAGAGGTTTGG -3'
(R):5'- TGGATCAGTTCATGGGTAGAAAGTC -3'
Posted On2015-01-23