Incidental Mutation 'R2874:Stx3'
ID260487
Institutional Source Beutler Lab
Gene Symbol Stx3
Ensembl Gene ENSMUSG00000041488
Gene Namesyntaxin 3
SynonymsSyn-3, syntaxin 3B, syntaxin 3A
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2874 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11775118-11819403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11789574 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 91 (V91D)
Ref Sequence ENSEMBL: ENSMUSP00000074776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047698] [ENSMUST00000069285] [ENSMUST00000075304] [ENSMUST00000211047] [ENSMUST00000211641]
Predicted Effect probably benign
Transcript: ENSMUST00000047698
SMART Domains Protein: ENSMUSP00000037317
Gene: ENSMUSG00000041488

DomainStartEndE-ValueType
SynN 27 146 5.39e-41 SMART
t_SNARE 186 253 1.07e-19 SMART
transmembrane domain 265 286 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069285
AA Change: V91D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069529
Gene: ENSMUSG00000041488
AA Change: V91D

DomainStartEndE-ValueType
SynN 27 146 5.39e-41 SMART
t_SNARE 186 253 6.87e-18 SMART
transmembrane domain 264 286 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075304
AA Change: V91D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074776
Gene: ENSMUSG00000041488
AA Change: V91D

DomainStartEndE-ValueType
SynN 27 128 1.13e-16 SMART
t_SNARE 168 235 1.07e-19 SMART
transmembrane domain 247 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210481
Predicted Effect probably damaging
Transcript: ENSMUST00000211047
AA Change: V91D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211641
AA Change: V73D

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.3577 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the syntaxin family. The encoded protein is targeted to the apical membrane of epithelial cells where it forms clusters and is important in establishing and maintaining polarity necessary for protein trafficking involving vesicle fusion and exocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Stx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Stx3 APN 19 11791788 missense probably damaging 0.99
IGL01578:Stx3 APN 19 11786605 missense probably damaging 1.00
IGL02086:Stx3 APN 19 11818682 splice site probably benign
IGL02487:Stx3 APN 19 11783105 missense probably damaging 0.96
R0124:Stx3 UTSW 19 11791799 missense possibly damaging 0.83
R0573:Stx3 UTSW 19 11785746 missense probably damaging 1.00
R1739:Stx3 UTSW 19 11785523 missense probably damaging 1.00
R2869:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R2869:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R2870:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R2870:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R4864:Stx3 UTSW 19 11777151 missense possibly damaging 0.79
R6156:Stx3 UTSW 19 11803510 missense probably damaging 1.00
R7298:Stx3 UTSW 19 11790048 nonsense probably null
R7443:Stx3 UTSW 19 11791844 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CAGTGCTGGGGTTTTCAACTAC -3'
(R):5'- CATTGAGATGAGCACTGAAGTG -3'

Sequencing Primer
(F):5'- GGGGTTTTCAACTACAGTGAGAACTC -3'
(R):5'- TGAGCACTGAAGTGGCAGC -3'
Posted On2015-01-23