Incidental Mutation 'R2874:Plxna3'
ID260489
Institutional Source Beutler Lab
Gene Symbol Plxna3
Ensembl Gene ENSMUSG00000031398
Gene Nameplexin A3
SynonymsPlexA3, Plxa3, Plxn4, SEX, Plxn3
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R2874 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location74329066-74344689 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 74339396 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004326]
PDB Structure Crystal strucure of mouse Plexin A3 intracellular domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000004326
SMART Domains Protein: ENSMUSP00000004326
Gene: ENSMUSG00000031398

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 473 1.81e-129 SMART
PSI 491 541 2.26e-11 SMART
PSI 638 685 3.62e-10 SMART
PSI 786 839 4.03e-8 SMART
IPT 840 934 8.07e-23 SMART
IPT 935 1021 2.99e-17 SMART
IPT 1023 1123 4.19e-21 SMART
IPT 1125 1220 1.49e-3 SMART
transmembrane domain 1221 1243 N/A INTRINSIC
Pfam:Plexin_cytopl 1294 1842 2.8e-253 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154062
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin class of proteins. The encoded protein is a class 3 semaphorin receptor, and may be involved in cytoskeletal remodeling and as well as apoptosis. Studies of a similar gene in zebrafish suggest that it is important for axon pathfinding in the developing nervous system. This gene may be associated with tumor progression. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene possess misdirected axons in the hippocampus. They are, otherwise, indistinguishable from wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Plxna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Plxna3 APN X 74335794 missense probably damaging 1.00
IGL01509:Plxna3 APN X 74332433 missense probably benign 0.00
IGL01511:Plxna3 APN X 74335308 missense probably damaging 0.98
IGL01694:Plxna3 APN X 74338508 missense probably damaging 1.00
IGL02511:Plxna3 APN X 74335385 missense probably damaging 0.99
R1544:Plxna3 UTSW X 74340166 splice site probably null
R2872:Plxna3 UTSW X 74339396 splice site probably benign
R4672:Plxna3 UTSW X 74338948 critical splice donor site probably null
R4673:Plxna3 UTSW X 74338948 critical splice donor site probably null
Z1176:Plxna3 UTSW X 74336020 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATTGATTGATAAGCCAGACAG -3'
(R):5'- TCCATGTCCTCAGCTTTGGG -3'

Sequencing Primer
(F):5'- CAGACAGGCAGCCAGCTATG -3'
(R):5'- GCTGAGAGTATGGAATACCCTTGTAC -3'
Posted On2015-01-23