Incidental Mutation 'R2874:Frmpd4'
ID260492
Institutional Source Beutler Lab
Gene Symbol Frmpd4
Ensembl Gene ENSMUSG00000049176
Gene NameFERM and PDZ domain containing 4
SynonymsPreso1, Pdzk10, LOC237234, Pdzd10, PKAP1, Preso
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2874 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location167471309-168577231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 167477247 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1166 (D1166E)
Ref Sequence ENSEMBL: ENSMUSP00000107777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112145] [ENSMUST00000112146] [ENSMUST00000112147] [ENSMUST00000112149]
Predicted Effect probably benign
Transcript: ENSMUST00000112145
AA Change: D1158E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107773
Gene: ENSMUSG00000049176
AA Change: D1158E

DomainStartEndE-ValueType
PDZ 77 147 1.38e-12 SMART
B41 194 416 1.86e-49 SMART
low complexity region 734 745 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
Blast:B41 794 864 9e-6 BLAST
low complexity region 865 874 N/A INTRINSIC
low complexity region 892 905 N/A INTRINSIC
low complexity region 1210 1224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112146
AA Change: D1126E

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107774
Gene: ENSMUSG00000049176
AA Change: D1126E

DomainStartEndE-ValueType
PDZ 45 115 1.38e-12 SMART
B41 162 384 1.86e-49 SMART
low complexity region 702 713 N/A INTRINSIC
low complexity region 730 743 N/A INTRINSIC
Blast:B41 762 832 1e-5 BLAST
low complexity region 833 842 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
low complexity region 1178 1192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112147
AA Change: D1158E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107775
Gene: ENSMUSG00000049176
AA Change: D1158E

DomainStartEndE-ValueType
PDZ 77 147 1.38e-12 SMART
B41 194 416 1.86e-49 SMART
low complexity region 734 745 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
Blast:B41 794 864 9e-6 BLAST
low complexity region 865 874 N/A INTRINSIC
low complexity region 892 905 N/A INTRINSIC
low complexity region 1210 1224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112149
AA Change: D1166E

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107777
Gene: ENSMUSG00000049176
AA Change: D1166E

DomainStartEndE-ValueType
PDZ 85 155 1.38e-12 SMART
B41 202 424 1.86e-49 SMART
low complexity region 742 753 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
Blast:B41 802 872 1e-5 BLAST
low complexity region 873 882 N/A INTRINSIC
low complexity region 900 913 N/A INTRINSIC
low complexity region 1218 1232 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain (WW, PDZ, FERM) containing protein. Through its interaction with other proteins (such as PSD-95), it functions as a positive regulator of dendritic spine morphogenesis and density, and is required for the maintenance of excitatory synaptic transmission. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased inflammation-induced pain and thermal pain in a chronic pain model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Frmpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Frmpd4 APN X 167492935 missense probably damaging 1.00
IGL02476:Frmpd4 APN X 167497855 missense probably damaging 1.00
IGL03142:Frmpd4 APN X 167479483 missense possibly damaging 0.86
IGL03292:Frmpd4 APN X 167477590 missense probably benign
PIT4283001:Frmpd4 UTSW X 167729034 missense possibly damaging 0.95
R0647:Frmpd4 UTSW X 167489010 missense probably damaging 1.00
R1520:Frmpd4 UTSW X 167492953 missense probably damaging 1.00
R2869:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2869:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2871:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2871:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2872:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2872:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R3729:Frmpd4 UTSW X 167486807 missense probably damaging 0.96
R3731:Frmpd4 UTSW X 167486807 missense probably damaging 0.96
R6943:Frmpd4 UTSW X 167604583 missense probably damaging 1.00
Z1088:Frmpd4 UTSW X 167497840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGTGCTTCCCCATGGAC -3'
(R):5'- CATGAAAGTCTTTCCCAGAGGTC -3'

Sequencing Primer
(F):5'- AGGCACTGCTACTGCTGC -3'
(R):5'- TTTCCCAGAGGTCCAGGCTTG -3'
Posted On2015-01-23