Incidental Mutation 'R2875:Rhbdd1'
ID260494
Institutional Source Beutler Lab
Gene Symbol Rhbdd1
Ensembl Gene ENSMUSG00000026142
Gene Namerhomboid domain containing 1
Synonyms4930418P06Rik
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R2875 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location82316452-82445366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82368369 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 215 (D215G)
Ref Sequence ENSEMBL: ENSMUSP00000137770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027322] [ENSMUST00000140020]
Predicted Effect probably benign
Transcript: ENSMUST00000027322
AA Change: D215G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027322
Gene: ENSMUSG00000026142
AA Change: D215G

DomainStartEndE-ValueType
Pfam:Rhomboid 60 213 6.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140020
AA Change: D215G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137770
Gene: ENSMUSG00000026142
AA Change: D215G

DomainStartEndE-ValueType
Pfam:Rhomboid 59 213 2.7e-20 PFAM
Predicted Effect
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Rhbdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Rhbdd1 APN 1 82340444 missense possibly damaging 0.94
IGL00957:Rhbdd1 APN 1 82340641 missense probably damaging 1.00
IGL01771:Rhbdd1 APN 1 82377592 missense probably benign 0.41
IGL01980:Rhbdd1 APN 1 82340834 splice site probably benign
IGL02654:Rhbdd1 APN 1 82342783 missense probably benign 0.16
R0167:Rhbdd1 UTSW 1 82342784 missense probably benign 0.00
R2005:Rhbdd1 UTSW 1 82340810 missense probably benign 0.00
R2876:Rhbdd1 UTSW 1 82368369 missense probably benign 0.02
R4058:Rhbdd1 UTSW 1 82370381 missense possibly damaging 0.80
R5572:Rhbdd1 UTSW 1 82340810 missense possibly damaging 0.52
R6526:Rhbdd1 UTSW 1 82340659 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGGAACAGAGCATGCAGTC -3'
(R):5'- TGGAGTTCCATTCTCGTTCATG -3'

Sequencing Primer
(F):5'- CAGAGCATGCAGTCTGTGACTAATTG -3'
(R):5'- CTCGTTCATGGAGCAATGC -3'
Posted On2015-01-23