Incidental Mutation 'R2875:Stk25'
ID260495
Institutional Source Beutler Lab
Gene Symbol Stk25
Ensembl Gene ENSMUSG00000026277
Gene Nameserine/threonine kinase 25 (yeast)
Synonyms1500019J11Rik, SOK-1, Ste20-like, Ysk1
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2875 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93619751-93658659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93629251 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 15 (D15G)
Ref Sequence ENSEMBL: ENSMUSP00000140396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027498] [ENSMUST00000133769] [ENSMUST00000186287]
Predicted Effect probably benign
Transcript: ENSMUST00000027498
AA Change: D15G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027498
Gene: ENSMUSG00000026277
AA Change: D15G

DomainStartEndE-ValueType
S_TKc 20 270 2.92e-98 SMART
low complexity region 292 314 N/A INTRINSIC
PDB:3W8H|B 355 426 8e-43 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125778
Predicted Effect probably benign
Transcript: ENSMUST00000133769
AA Change: D15G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117765
Gene: ENSMUSG00000026277
AA Change: D15G

DomainStartEndE-ValueType
Pfam:Pkinase 20 233 1.7e-63 PFAM
Pfam:Pkinase_Tyr 20 233 2.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154008
Predicted Effect possibly damaging
Transcript: ENSMUST00000186287
AA Change: D15G

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140396
Gene: ENSMUSG00000026277
AA Change: D15G

DomainStartEndE-ValueType
STYKc 20 107 1.9e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the germinal centre kinase III (GCK III) subfamily of the sterile 20 superfamily of kinases. The encoded enzyme plays a role in serine-threonine liver kinase B1 (LKB1) signaling pathway to regulate neuronal polarization and morphology of the Golgi apparatus. The protein is translocated from the Golgi apparatus to the nucleus in response to chemical anoxia and plays a role in regulation of cell death. A pseudogene associated with this gene is located on chromosome 18. Multiple alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Germ line null mutants display normal cortical layers and neuronal migration. Acute loss of expression results in impaired neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Stk25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Stk25 APN 1 93623423 splice site probably null
IGL02952:Stk25 APN 1 93626076 missense probably damaging 1.00
IGL03144:Stk25 APN 1 93629136 missense probably damaging 1.00
ANU05:Stk25 UTSW 1 93623423 splice site probably null
IGL02980:Stk25 UTSW 1 93627668 missense probably damaging 1.00
PIT4531001:Stk25 UTSW 1 93624624 missense probably benign
R0240:Stk25 UTSW 1 93627060 missense probably damaging 1.00
R0240:Stk25 UTSW 1 93627060 missense probably damaging 1.00
R0555:Stk25 UTSW 1 93624591 missense probably benign 0.00
R1178:Stk25 UTSW 1 93623389 unclassified probably benign
R1406:Stk25 UTSW 1 93625153 unclassified probably benign
R1493:Stk25 UTSW 1 93625600 missense probably benign 0.04
R4657:Stk25 UTSW 1 93625656 unclassified probably benign
R4668:Stk25 UTSW 1 93625483 missense probably damaging 1.00
R4686:Stk25 UTSW 1 93623420 splice site probably null
R5089:Stk25 UTSW 1 93624608 missense probably benign 0.05
R5493:Stk25 UTSW 1 93635309 missense probably benign
R6013:Stk25 UTSW 1 93625459 critical splice donor site probably null
X0063:Stk25 UTSW 1 93625961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGACTGTCACATTGGCTG -3'
(R):5'- GAATATAGTGTCAGTTGGAGAGTGC -3'

Sequencing Primer
(F):5'- CATTGGCTGAGCACAGTGATCTC -3'
(R):5'- TAGGTTTTCTGAACAAGGGATAAAG -3'
Posted On2015-01-23