Incidental Mutation 'R2875:Rad54l'
ID260504
Institutional Source Beutler Lab
Gene Symbol Rad54l
Ensembl Gene ENSMUSG00000028702
Gene NameRAD54 like (S. cerevisiae)
SynonymsRAD54
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2875 (G1)
Quality Score191
Status Not validated
Chromosome4
Chromosomal Location116094264-116123690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116101853 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 382 (R382Q)
Ref Sequence ENSEMBL: ENSMUSP00000099766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030471] [ENSMUST00000102704] [ENSMUST00000102705]
Predicted Effect probably benign
Transcript: ENSMUST00000030471
SMART Domains Protein: ENSMUSP00000030471
Gene: ENSMUSG00000028703

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 352 382 N/A INTRINSIC
low complexity region 417 429 N/A INTRINSIC
SCOP:d1yrga_ 449 742 4e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102704
AA Change: R382Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099765
Gene: ENSMUSG00000028702
AA Change: R382Q

DomainStartEndE-ValueType
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102705
AA Change: R382Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099766
Gene: ENSMUSG00000028702
AA Change: R382Q

DomainStartEndE-ValueType
Pfam:Rad54_N 10 138 7.8e-9 PFAM
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139147
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily, and shares similarity with Saccharomyces cerevisiae Rad54, a protein known to be involved in the homologous recombination and repair of DNA. This protein has been shown to play a role in homologous recombination related repair of DNA double-strand breaks. The binding of this protein to double-strand DNA induces a DNA topological change, which is thought to facilitate homologous DNA paring, and stimulate DNA recombination. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are sensitive to DNA crosslinking agents and to ionizing radiation and show abnormal definitive hematopoiesis following X-ray treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Rad54l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Rad54l APN 4 116105877 missense probably damaging 1.00
IGL01569:Rad54l APN 4 116098998 missense probably damaging 1.00
IGL02120:Rad54l APN 4 116098984 missense probably benign 0.44
IGL02587:Rad54l APN 4 116105797 missense probably damaging 1.00
IGL02728:Rad54l APN 4 116122949 missense probably benign 0.00
IGL03114:Rad54l APN 4 116098532 missense probably damaging 1.00
R0690:Rad54l UTSW 4 116099750 splice site probably benign
R1179:Rad54l UTSW 4 116111320 missense probably benign 0.14
R1956:Rad54l UTSW 4 116110357 missense probably damaging 0.99
R2936:Rad54l UTSW 4 116122879 intron probably benign
R4237:Rad54l UTSW 4 116099449 missense probably damaging 1.00
R4344:Rad54l UTSW 4 116097354 missense probably damaging 1.00
R4801:Rad54l UTSW 4 116122924 missense probably null 0.12
R4802:Rad54l UTSW 4 116122924 missense probably null 0.12
R5106:Rad54l UTSW 4 116099764 intron probably benign
R5644:Rad54l UTSW 4 116098947 missense probably benign
R5684:Rad54l UTSW 4 116100563 missense probably damaging 1.00
R5883:Rad54l UTSW 4 116099046 intron probably benign
R5963:Rad54l UTSW 4 116110387 missense probably damaging 1.00
R6035:Rad54l UTSW 4 116097469 missense probably damaging 1.00
R6035:Rad54l UTSW 4 116097469 missense probably damaging 1.00
R6369:Rad54l UTSW 4 116111189 critical splice donor site probably null
R6863:Rad54l UTSW 4 116099669 missense probably damaging 1.00
R7135:Rad54l UTSW 4 116105830 missense probably damaging 1.00
R7318:Rad54l UTSW 4 116110709 missense possibly damaging 0.91
R7767:Rad54l UTSW 4 116099669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGGGCTACTCAAAGGAGAC -3'
(R):5'- TCACAAGGTGGCCTGTCATTAG -3'

Sequencing Primer
(F):5'- GGAGACTTATCCTGTACGACCATG -3'
(R):5'- GCCTGTCATTAGCAGTGAGAAAATC -3'
Posted On2015-01-23