Incidental Mutation 'R2875:Zcwpw1'
ID260505
Institutional Source Beutler Lab
Gene Symbol Zcwpw1
Ensembl Gene ENSMUSG00000037108
Gene Namezinc finger, CW type with PWWP domain 1
SynonymsLOC381678
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R2875 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137787798-137822621 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137810042 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 251 (S251P)
Ref Sequence ENSEMBL: ENSMUSP00000048730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035852]
Predicted Effect probably damaging
Transcript: ENSMUST00000035852
AA Change: S251P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048730
Gene: ENSMUSG00000037108
AA Change: S251P

DomainStartEndE-ValueType
Pfam:zf-CW 246 293 7.3e-18 PFAM
Pfam:PWWP 306 401 6.9e-22 PFAM
coiled coil region 440 462 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128946
Predicted Effect probably benign
Transcript: ENSMUST00000141642
SMART Domains Protein: ENSMUSP00000120909
Gene: ENSMUSG00000037108

DomainStartEndE-ValueType
Pfam:PWWP 21 109 8.2e-19 PFAM
coiled coil region 126 148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Zcwpw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Zcwpw1 APN 5 137796799 missense probably benign 0.42
IGL02316:Zcwpw1 APN 5 137810010 unclassified probably benign
IGL02336:Zcwpw1 APN 5 137810114 missense probably damaging 0.96
R0103:Zcwpw1 UTSW 5 137810113 nonsense probably null
R0103:Zcwpw1 UTSW 5 137810113 nonsense probably null
R0295:Zcwpw1 UTSW 5 137817472 missense probably damaging 1.00
R0514:Zcwpw1 UTSW 5 137796683 missense probably benign 0.26
R0685:Zcwpw1 UTSW 5 137799592 missense probably benign 0.00
R0698:Zcwpw1 UTSW 5 137817521 missense probably benign
R0727:Zcwpw1 UTSW 5 137810807 unclassified probably benign
R1677:Zcwpw1 UTSW 5 137796760 missense probably damaging 0.99
R1780:Zcwpw1 UTSW 5 137796652 missense probably damaging 0.98
R1938:Zcwpw1 UTSW 5 137811622 missense probably damaging 0.99
R4177:Zcwpw1 UTSW 5 137800133 missense probably damaging 0.99
R5073:Zcwpw1 UTSW 5 137795519 start codon destroyed probably null 0.81
R5913:Zcwpw1 UTSW 5 137800007 missense probably benign 0.31
R6224:Zcwpw1 UTSW 5 137812036 missense possibly damaging 0.63
R6542:Zcwpw1 UTSW 5 137812020 missense probably damaging 0.98
R7204:Zcwpw1 UTSW 5 137812084 missense probably damaging 0.98
R7542:Zcwpw1 UTSW 5 137819523 missense probably benign 0.00
R7600:Zcwpw1 UTSW 5 137800134 nonsense probably null
R7911:Zcwpw1 UTSW 5 137796770 missense probably null 1.00
R7972:Zcwpw1 UTSW 5 137801061 missense probably benign 0.13
R7988:Zcwpw1 UTSW 5 137817491 missense possibly damaging 0.69
R8174:Zcwpw1 UTSW 5 137819577 critical splice donor site probably null
X0021:Zcwpw1 UTSW 5 137811607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCAGTTCTGTCACCAAGTTAG -3'
(R):5'- CTTAGCTGAAAGGAGACATGTTGG -3'

Sequencing Primer
(F):5'- AGGTTGGCCTTCAGTAAAATGC -3'
(R):5'- CTGAAAGGAGACATGTTGGGAAAG -3'
Posted On2015-01-23