Incidental Mutation 'R2875:St3gal5'
ID260507
Institutional Source Beutler Lab
Gene Symbol St3gal5
Ensembl Gene ENSMUSG00000056091
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 5
SynonymsGM3-specific sialytransferase, 3S-T, mST3Gal V, ST3Gal V, GM3 synthase, Siat9, [a]2
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R2875 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location72097592-72154571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72147130 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 214 (M214V)
Ref Sequence ENSEMBL: ENSMUSP00000109747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069994] [ENSMUST00000114112] [ENSMUST00000188366]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069994
AA Change: M241V

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070414
Gene: ENSMUSG00000056091
AA Change: M241V

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:Glyco_transf_29 141 411 3e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114112
AA Change: M214V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109747
Gene: ENSMUSG00000056091
AA Change: M214V

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Glyco_transf_29 111 385 4.9e-71 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000187007
AA Change: M215V
Predicted Effect probably benign
Transcript: ENSMUST00000188366
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ganglioside GM3 is known to participate in the induction of cell differentiation, modulation of cell proliferation, maintenance of fibroblast morphology, signal transduction, and integrin-mediated cell adhesion. The protein encoded by this gene is a type II membrane protein which catalyzes the formation of GM3 using lactosylceramide as the substrate. The encoded protein is a member of glycosyltransferase family 29 and may be localized to the Golgi apparatus. Mutation in this gene has been associated with Amish infantile epilepsy syndrome. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene leads to inability to synthesize GM3 ganglioside. Homozygotes for a null allele exhibit enhanced sensitivity to insulin. Homozygotes for a different null allele show resistance to botulinum neurotoxin type C. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in St3gal5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:St3gal5 APN 6 72128282 missense probably benign 0.00
IGL02277:St3gal5 APN 6 72142200 missense possibly damaging 0.50
IGL02756:St3gal5 APN 6 72149173 missense probably null 0.83
IGL02904:St3gal5 APN 6 72147124 missense possibly damaging 0.94
R0107:St3gal5 UTSW 6 72142149 missense probably benign 0.11
R1605:St3gal5 UTSW 6 72142288 missense probably benign 0.42
R1854:St3gal5 UTSW 6 72132093 missense probably damaging 1.00
R3692:St3gal5 UTSW 6 72149029 missense probably benign 0.05
R5071:St3gal5 UTSW 6 72132053 missense probably damaging 1.00
R5265:St3gal5 UTSW 6 72149131 missense probably damaging 1.00
R5609:St3gal5 UTSW 6 72153462 missense possibly damaging 0.75
R8085:St3gal5 UTSW 6 72097941 missense unknown
R8199:St3gal5 UTSW 6 72142191 missense probably benign
R8251:St3gal5 UTSW 6 72149160 missense probably benign 0.03
R8294:St3gal5 UTSW 6 72097832 missense
R8332:St3gal5 UTSW 6 72142181 nonsense probably null
R8410:St3gal5 UTSW 6 72142297 missense probably benign 0.00
RF060:St3gal5 UTSW 6 72097852 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGTCAGTGTTGTGAAGTGC -3'
(R):5'- TCCATAATTGCAATCCAAGATGCTC -3'

Sequencing Primer
(F):5'- GAAGCCTGTTCCAACAATGTCCTG -3'
(R):5'- TTGCAATCCAAGATGCTCTAAGC -3'
Posted On2015-01-23