Incidental Mutation 'R2875:Kcnc3'
ID260510
Institutional Source Beutler Lab
Gene Symbol Kcnc3
Ensembl Gene ENSMUSG00000062785
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 3
SynonymsKcr2-3, KShIIID, Kv3.3
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2875 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44590664-44604754 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 44591537 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 218 (G218*)
Ref Sequence ENSEMBL: ENSMUSP00000146535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002274] [ENSMUST00000107906] [ENSMUST00000107907] [ENSMUST00000207493] [ENSMUST00000208651] [ENSMUST00000209177]
Predicted Effect probably benign
Transcript: ENSMUST00000002274
SMART Domains Protein: ENSMUSP00000002274
Gene: ENSMUSG00000002204

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Asp 72 396 6.6e-109 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000071062
AA Change: G218*
SMART Domains Protein: ENSMUSP00000069754
Gene: ENSMUSG00000062785
AA Change: G218*

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
BTB 90 194 4.38e-12 SMART
low complexity region 211 243 N/A INTRINSIC
low complexity region 251 267 N/A INTRINSIC
Pfam:Ion_trans 351 539 1.4e-31 PFAM
Pfam:Ion_trans_2 450 544 2.2e-11 PFAM
low complexity region 578 605 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107905
AA Change: G218*
SMART Domains Protein: ENSMUSP00000103538
Gene: ENSMUSG00000062785
AA Change: G218*

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
BTB 90 194 4.38e-12 SMART
low complexity region 211 243 N/A INTRINSIC
low complexity region 251 267 N/A INTRINSIC
Pfam:Ion_trans 351 539 1.4e-31 PFAM
Pfam:Ion_trans_2 450 544 2.2e-11 PFAM
low complexity region 578 605 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107906
AA Change: G218*
SMART Domains Protein: ENSMUSP00000103539
Gene: ENSMUSG00000062785
AA Change: G218*

DomainStartEndE-ValueType
Pfam:Potassium_chann 1 21 8e-9 PFAM
BTB 90 194 4.38e-12 SMART
low complexity region 211 243 N/A INTRINSIC
low complexity region 251 267 N/A INTRINSIC
Pfam:Ion_trans 290 551 4.1e-45 PFAM
Pfam:Ion_trans_2 451 544 8.2e-12 PFAM
low complexity region 578 605 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
low complexity region 750 767 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107907
AA Change: G218*
SMART Domains Protein: ENSMUSP00000103540
Gene: ENSMUSG00000062785
AA Change: G218*

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
BTB 90 194 4.38e-12 SMART
low complexity region 211 243 N/A INTRINSIC
low complexity region 251 267 N/A INTRINSIC
Pfam:Ion_trans 351 539 1.5e-31 PFAM
Pfam:Ion_trans_2 450 544 2.4e-11 PFAM
low complexity region 578 605 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
low complexity region 729 745 N/A INTRINSIC
low complexity region 749 766 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207302
Predicted Effect probably null
Transcript: ENSMUST00000207493
AA Change: G218*
Predicted Effect probably benign
Transcript: ENSMUST00000207497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208412
Predicted Effect probably null
Transcript: ENSMUST00000208651
AA Change: G218*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209101
Predicted Effect probably null
Transcript: ENSMUST00000209177
AA Change: G218*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Alternate splicing results in several transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozgous null mice show no overt phenotype, though mutation of this locus in conjunction with mutations in another potassium channel results in alcohol hypersensitivty, increased locomotion, and spontaneous myoclonus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Kcnc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Kcnc3 APN 7 44595386 missense probably damaging 1.00
IGL01607:Kcnc3 APN 7 44591304 missense probably damaging 1.00
IGL02397:Kcnc3 APN 7 44595794 missense probably damaging 1.00
IGL02807:Kcnc3 APN 7 44595957 missense probably damaging 1.00
IGL02961:Kcnc3 APN 7 44591492 missense probably damaging 0.99
elfen UTSW 7 44591296 frame shift probably null
Le_fitness UTSW 7 44595182 missense possibly damaging 0.92
Svelte UTSW 7 44595816 missense probably damaging 1.00
Trim UTSW 7 44595603 missense probably damaging 1.00
R0514:Kcnc3 UTSW 7 44595928 nonsense probably null
R0827:Kcnc3 UTSW 7 44595206 missense probably damaging 0.99
R1514:Kcnc3 UTSW 7 44595603 missense probably damaging 1.00
R4597:Kcnc3 UTSW 7 44595816 missense probably damaging 1.00
R4954:Kcnc3 UTSW 7 44591296 frame shift probably null
R4955:Kcnc3 UTSW 7 44591296 frame shift probably null
R6012:Kcnc3 UTSW 7 44598872 missense probably benign 0.26
R6093:Kcnc3 UTSW 7 44591508 missense probably benign 0.44
R6488:Kcnc3 UTSW 7 44595182 missense possibly damaging 0.92
R7542:Kcnc3 UTSW 7 44595714 missense possibly damaging 0.84
R7595:Kcnc3 UTSW 7 44591469 missense probably damaging 1.00
R7909:Kcnc3 UTSW 7 44595687 missense probably damaging 1.00
R7946:Kcnc3 UTSW 7 44596145 missense probably benign 0.13
Z1177:Kcnc3 UTSW 7 44596106 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTGCTCAACTACTACCGC -3'
(R):5'- GAAGGGCTTCCAGAGAACTG -3'

Sequencing Primer
(F):5'- GCAAACTGCACTGCCCG -3'
(R):5'- TAGGGGTCCTCAAAAAGCGCC -3'
Posted On2015-01-23