Incidental Mutation 'R2875:Olfr742'
ID260523
Institutional Source Beutler Lab
Gene Symbol Olfr742
Ensembl Gene ENSMUSG00000068431
Gene Nameolfactory receptor 742
SynonymsGA_x6K02T2PMLR-6224293-6225228, MOR106-6
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2875 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50503600-50517145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50515812 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 203 (W203R)
Ref Sequence ENSEMBL: ENSMUSP00000150814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089836] [ENSMUST00000213935] [ENSMUST00000217437]
Predicted Effect probably benign
Transcript: ENSMUST00000089836
AA Change: W203R

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000087273
Gene: ENSMUSG00000068431
AA Change: W203R

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.9e-55 PFAM
Pfam:7tm_1 45 294 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213935
AA Change: W203R

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000217437
AA Change: W203R

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Olfr742
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Olfr742 APN 14 50515443 missense probably damaging 0.97
R0046:Olfr742 UTSW 14 50516139 makesense probably null
R0369:Olfr742 UTSW 14 50515825 missense probably benign 0.00
R0612:Olfr742 UTSW 14 50515482 missense probably benign
R1588:Olfr742 UTSW 14 50516127 missense probably benign
R1726:Olfr742 UTSW 14 50516179 splice site probably null
R1998:Olfr742 UTSW 14 50515356 missense probably benign 0.00
R4009:Olfr742 UTSW 14 50515962 missense possibly damaging 0.77
R5119:Olfr742 UTSW 14 50515509 missense probably benign 0.00
R5232:Olfr742 UTSW 14 50516038 missense probably damaging 0.99
R5627:Olfr742 UTSW 14 50515800 missense probably benign
R5930:Olfr742 UTSW 14 50515792 missense probably benign
R6597:Olfr742 UTSW 14 50515551 missense probably benign 0.11
R7441:Olfr742 UTSW 14 50515396 missense probably damaging 1.00
R7596:Olfr742 UTSW 14 50515545 missense probably benign 0.14
R8051:Olfr742 UTSW 14 50515643 missense probably benign 0.00
R8294:Olfr742 UTSW 14 50515626 missense possibly damaging 0.81
R8329:Olfr742 UTSW 14 50515558 missense probably damaging 0.99
R8380:Olfr742 UTSW 14 50515840 missense probably benign 0.00
Z1088:Olfr742 UTSW 14 50515527 missense possibly damaging 0.90
Z1176:Olfr742 UTSW 14 50516065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACATCCTTGTGATCAGTTGC -3'
(R):5'- ACAAGCTTCTGCATTCCAGC -3'

Sequencing Primer
(F):5'- TGATCAGTTGCTGGGTGC -3'
(R):5'- CTCAGATGTTGGGCTCAAATAC -3'
Posted On2015-01-23