Incidental Mutation 'R2875:Uchl3'
ID260524
Institutional Source Beutler Lab
Gene Symbol Uchl3
Ensembl Gene ENSMUSG00000022111
Gene Nameubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
Synonyms
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2875 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location101653967-101696125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101668560 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 153 (H153R)
Ref Sequence ENSEMBL: ENSMUSP00000002289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002289]
Predicted Effect probably benign
Transcript: ENSMUST00000002289
AA Change: H153R

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000002289
Gene: ENSMUSG00000022111
AA Change: H153R

DomainStartEndE-ValueType
Pfam:Peptidase_C12 6 214 1.2e-68 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000226340
AA Change: H123R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228773
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the deubiquitinating enzyme family. Members of this family are proteases that catalyze the removal of ubiquitin from polypeptides and are divided into five classes, depending on the mechanism of catalysis. This protein may hydrolyze the ubiquitinyl-N-epsilon amide bond of ubiquitinated proteins to regenerate ubiquitin for another catalytic cycle. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null animals show degeneration in dorsal root ganglia. Mice display postnatal progressive retinal degeneration and muscular degeneration. In combination with a knockout of ubiquitin C-terminal hydrolase L1, neurological effects of each are accelerated, mice are dysphagic and die younger. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Uchl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0507:Uchl3 UTSW 14 101667007 nonsense probably null
R0992:Uchl3 UTSW 14 101668533 missense probably benign 0.08
R1365:Uchl3 UTSW 14 101654092 missense probably damaging 1.00
R2213:Uchl3 UTSW 14 101666670 critical splice donor site probably null
R5027:Uchl3 UTSW 14 101666546 missense possibly damaging 0.93
R5186:Uchl3 UTSW 14 101695917 missense probably damaging 1.00
R6737:Uchl3 UTSW 14 101690597 missense probably damaging 0.99
R7039:Uchl3 UTSW 14 101685692 intron probably benign
R8308:Uchl3 UTSW 14 101695219 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGTTCTGAAAGGTTTTGTGC -3'
(R):5'- TTAATGTAGCACGGTAGCAGC -3'

Sequencing Primer
(F):5'- GAAAGGTTTTGTGCTAAACTGCTCC -3'
(R):5'- GCAGCCTGGCAAAACATTTCATTTG -3'
Posted On2015-01-23