Incidental Mutation 'R2875:Ccdc152'
ID260525
Institutional Source Beutler Lab
Gene Symbol Ccdc152
Ensembl Gene ENSMUSG00000091119
Gene Namecoiled-coil domain containing 152
SynonymsENSMUSG00000071814
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R2875 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location3280070-3303526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3298181 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 38 (N38S)
Ref Sequence ENSEMBL: ENSMUSP00000153730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165386] [ENSMUST00000226261] [ENSMUST00000228405]
Predicted Effect probably damaging
Transcript: ENSMUST00000165386
AA Change: N38S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129305
Gene: ENSMUSG00000091119
AA Change: N38S

DomainStartEndE-ValueType
coiled coil region 76 186 N/A INTRINSIC
coiled coil region 211 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226261
AA Change: N38S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228405
AA Change: N38S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0784 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Ccdc152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Ccdc152 APN 15 3293847 splice site probably benign
IGL01543:Ccdc152 APN 15 3298124 missense possibly damaging 0.91
R0622:Ccdc152 UTSW 15 3298178 missense probably damaging 0.96
R1605:Ccdc152 UTSW 15 3298121 missense probably damaging 0.99
R2876:Ccdc152 UTSW 15 3298181 missense probably damaging 1.00
R4990:Ccdc152 UTSW 15 3301157 missense probably benign 0.00
R5114:Ccdc152 UTSW 15 3282837 missense probably damaging 0.99
R5732:Ccdc152 UTSW 15 3292378 critical splice donor site probably null
R6336:Ccdc152 UTSW 15 3301129 missense probably damaging 1.00
R6704:Ccdc152 UTSW 15 3280713 missense probably damaging 1.00
R7593:Ccdc152 UTSW 15 3280655 missense probably damaging 1.00
R8300:Ccdc152 UTSW 15 3298152 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTATGAGACAACACTCTGGAACATTC -3'
(R):5'- TTGAAGGCTCAATACAGTACGG -3'

Sequencing Primer
(F):5'- CACTCTGGAACATTCTATATGCACG -3'
(R):5'- GGCTCAATACAGTACGGTTTATTTG -3'
Posted On2015-01-23