Incidental Mutation 'R2875:Rad1'
ID 260526
Institutional Source Beutler Lab
Gene Symbol Rad1
Ensembl Gene ENSMUSG00000022248
Gene Name RAD1 checkpoint DNA exonuclease
Synonyms
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock # R2875 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 10486018-10499063 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10490331 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 128 (V128A)
Ref Sequence ENSEMBL: ENSMUSP00000126645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022855] [ENSMUST00000022856] [ENSMUST00000100775] [ENSMUST00000168408] [ENSMUST00000168761] [ENSMUST00000169050] [ENSMUST00000169519] [ENSMUST00000170100]
AlphaFold Q9QWZ1
Predicted Effect probably benign
Transcript: ENSMUST00000022855
SMART Domains Protein: ENSMUSP00000022855
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Brix 63 243 3.62e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022856
AA Change: V128A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000022856
Gene: ENSMUSG00000022248
AA Change: V128A

DomainStartEndE-ValueType
Pfam:Rad1 16 257 2.2e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100775
AA Change: V128A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000098338
Gene: ENSMUSG00000022248
AA Change: V128A

DomainStartEndE-ValueType
Pfam:Rad1 16 235 5.5e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168408
SMART Domains Protein: ENSMUSP00000132747
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 67 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168690
SMART Domains Protein: ENSMUSP00000132283
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Brix 22 147 5.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168761
SMART Domains Protein: ENSMUSP00000130602
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Blast:Brix 10 51 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169050
SMART Domains Protein: ENSMUSP00000127437
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Pfam:Brix 72 154 8.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169519
AA Change: V128A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126645
Gene: ENSMUSG00000022248
AA Change: V128A

DomainStartEndE-ValueType
Pfam:Rad1 16 133 9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170100
AA Change: V98A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128601
Gene: ENSMUSG00000022248
AA Change: V98A

DomainStartEndE-ValueType
Pfam:Rad1 1 161 1.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170531
Meta Mutation Damage Score 0.2799 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a heterotrimeric cell cycle checkpoint complex, known as the 9-1-1 complex, that is activated to stop cell cycle progression in response to DNA damage or incomplete DNA replication. The 9-1-1 complex is recruited by RAD17 to affected sites where it may attract specialized DNA polymerases and other DNA repair effectors. Alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit normal B cell DNA damage sensitivity, somatic hypermutation, and class switch recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Rad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Rad1 APN 15 10490409 missense probably benign 0.06
IGL01536:Rad1 APN 15 10493200 missense possibly damaging 0.94
IGL01544:Rad1 APN 15 10490379 missense probably damaging 0.99
IGL02058:Rad1 APN 15 10493275 missense probably benign 0.01
IGL02368:Rad1 APN 15 10493251 missense probably benign 0.19
IGL02793:Rad1 APN 15 10493279 missense probably benign 0.00
IGL02875:Rad1 APN 15 10493279 missense probably benign 0.00
R0271:Rad1 UTSW 15 10490457 splice site probably null
R1874:Rad1 UTSW 15 10488006 missense probably damaging 1.00
R2154:Rad1 UTSW 15 10486635 missense possibly damaging 0.77
R2318:Rad1 UTSW 15 10490409 missense probably benign 0.06
R2369:Rad1 UTSW 15 10486659 missense probably damaging 1.00
R2876:Rad1 UTSW 15 10490331 missense probably benign 0.09
R2915:Rad1 UTSW 15 10486642 missense probably damaging 0.99
R3721:Rad1 UTSW 15 10488026 missense probably benign 0.00
R4754:Rad1 UTSW 15 10493126 intron probably benign
R4931:Rad1 UTSW 15 10492762 intron probably benign
R5274:Rad1 UTSW 15 10487973 splice site probably null
R5640:Rad1 UTSW 15 10495923 missense possibly damaging 0.47
R5885:Rad1 UTSW 15 10488057 missense probably damaging 1.00
R6056:Rad1 UTSW 15 10488074 missense probably damaging 0.99
R6341:Rad1 UTSW 15 10492821 missense probably damaging 0.99
R6420:Rad1 UTSW 15 10488012 missense probably benign 0.00
R7068:Rad1 UTSW 15 10490293 nonsense probably null
R7205:Rad1 UTSW 15 10493257 missense probably benign 0.00
R7312:Rad1 UTSW 15 10493281 missense probably benign 0.00
R7817:Rad1 UTSW 15 10493318 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGCATGCTAGAAGCTTGG -3'
(R):5'- TGAAGGGTAATCGCACTGACG -3'

Sequencing Primer
(F):5'- CTTGGCAGATAAATTATTCTTGAGGC -3'
(R):5'- GTAATCGCACTGACGTACCTG -3'
Posted On 2015-01-23