Incidental Mutation 'R2875:Mgrn1'
ID260529
Institutional Source Beutler Lab
Gene Symbol Mgrn1
Ensembl Gene ENSMUSG00000022517
Gene Namemahogunin, ring finger 1
Synonyms2610042J20Rik, nc
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2875 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location4886249-4938296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4907416 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 47 (T47I)
Ref Sequence ENSEMBL: ENSMUSP00000155034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023159] [ENSMUST00000070658] [ENSMUST00000229038] [ENSMUST00000230990]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023159
AA Change: T46I

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023159
Gene: ENSMUSG00000022517
AA Change: T46I

DomainStartEndE-ValueType
low complexity region 205 216 N/A INTRINSIC
low complexity region 268 278 N/A INTRINSIC
RING 279 317 4.58e-4 SMART
low complexity region 349 360 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070658
AA Change: T46I

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000068314
Gene: ENSMUSG00000022517
AA Change: T46I

DomainStartEndE-ValueType
low complexity region 204 215 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
RING 278 316 4.58e-4 SMART
low complexity region 348 359 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000229038
AA Change: T47I

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230990
AA Change: T46I

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mahogunin (MGRN1) is a C3HC4 RING-containing protein with E3 ubiquitin ligase activity in vitro.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygotes for mutant alleles exhibit darkening of agouti hair and suppression of the obesity associated with certain agouti mutations. Homozygotes for an induced null mutation also have curly whiskers and develop a progressive spongiform neuropathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Mgrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Mgrn1 APN 16 4916155 critical splice donor site probably null
IGL02175:Mgrn1 APN 16 4920368 missense probably benign 0.02
IGL02382:Mgrn1 APN 16 4922618 missense probably damaging 0.97
R1204:Mgrn1 UTSW 16 4907409 missense probably damaging 1.00
R1515:Mgrn1 UTSW 16 4915780 missense probably benign 0.11
R1625:Mgrn1 UTSW 16 4910763 missense probably damaging 1.00
R4928:Mgrn1 UTSW 16 4927862 missense probably benign 0.29
R4955:Mgrn1 UTSW 16 4934219 missense probably benign 0.00
R6085:Mgrn1 UTSW 16 4920376 missense probably benign 0.01
R6189:Mgrn1 UTSW 16 4910810 critical splice donor site probably null
R7095:Mgrn1 UTSW 16 4927664 splice site probably null
R7293:Mgrn1 UTSW 16 4932220 missense probably benign 0.01
R7610:Mgrn1 UTSW 16 4934233 makesense probably null
R8187:Mgrn1 UTSW 16 4920365 missense probably benign 0.02
R8376:Mgrn1 UTSW 16 4915766 missense probably damaging 1.00
Z1177:Mgrn1 UTSW 16 4922724 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATGGTGTGCAGCAAACTGG -3'
(R):5'- CAAGTCACATGGCCACGTTC -3'

Sequencing Primer
(F):5'- AGCAAACTGGCTGAGGAC -3'
(R):5'- ATGGCCACGTTCAGCTCTG -3'
Posted On2015-01-23