Incidental Mutation 'R2875:Ndst1'
ID260534
Institutional Source Beutler Lab
Gene Symbol Ndst1
Ensembl Gene ENSMUSG00000054008
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonymsglucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2875 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location60685978-60713389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60690047 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 816 (F816I)
Ref Sequence ENSEMBL: ENSMUSP00000126623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169273]
Predicted Effect probably damaging
Transcript: ENSMUST00000169273
AA Change: F816I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: F816I

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:HSNSD 25 515 5.1e-254 PFAM
Pfam:Sulfotransfer_1 604 869 2.2e-48 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Ndst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ndst1 APN 18 60707956 missense probably damaging 1.00
IGL01410:Ndst1 APN 18 60700445 missense probably damaging 1.00
IGL01578:Ndst1 APN 18 60713126 missense probably damaging 1.00
IGL02133:Ndst1 APN 18 60699546 missense probably benign 0.05
IGL03200:Ndst1 APN 18 60699539 missense possibly damaging 0.86
R0631:Ndst1 UTSW 18 60700359 splice site probably benign
R0899:Ndst1 UTSW 18 60707882 missense probably benign 0.00
R1104:Ndst1 UTSW 18 60697146 missense probably damaging 0.98
R1371:Ndst1 UTSW 18 60707647 missense possibly damaging 0.90
R1456:Ndst1 UTSW 18 60713205 missense possibly damaging 0.73
R1511:Ndst1 UTSW 18 60697170 missense possibly damaging 0.61
R1524:Ndst1 UTSW 18 60698504 missense probably damaging 0.99
R1699:Ndst1 UTSW 18 60695508 missense probably damaging 1.00
R1718:Ndst1 UTSW 18 60707803 missense probably damaging 0.99
R1772:Ndst1 UTSW 18 60702837 missense probably damaging 0.99
R1900:Ndst1 UTSW 18 60712721 critical splice donor site probably null
R2079:Ndst1 UTSW 18 60695509 missense probably damaging 1.00
R2105:Ndst1 UTSW 18 60691253 missense probably benign 0.01
R2127:Ndst1 UTSW 18 60691208 missense probably benign 0.00
R3798:Ndst1 UTSW 18 60713166 missense possibly damaging 0.94
R3950:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3951:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3952:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R4868:Ndst1 UTSW 18 60695476 missense probably benign 0.07
R4898:Ndst1 UTSW 18 60691987 missense probably benign 0.12
R4988:Ndst1 UTSW 18 60702933 missense probably damaging 0.99
R5271:Ndst1 UTSW 18 60705132 missense probably benign 0.03
R5337:Ndst1 UTSW 18 60690007 missense probably damaging 1.00
R5467:Ndst1 UTSW 18 60692021 missense probably benign
R5830:Ndst1 UTSW 18 60703838 missense probably damaging 1.00
R5968:Ndst1 UTSW 18 60713076 missense probably benign
R6241:Ndst1 UTSW 18 60703829 missense probably damaging 0.99
R6422:Ndst1 UTSW 18 60702953 missense probably benign 0.44
R7099:Ndst1 UTSW 18 60695500 missense possibly damaging 0.88
R7544:Ndst1 UTSW 18 60697184 missense probably damaging 1.00
V8831:Ndst1 UTSW 18 60702927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGATGCCTGCTGTGTAAG -3'
(R):5'- ACCAGAGTGACTTAGAACATGG -3'

Sequencing Primer
(F):5'- CTGCTGTGTAAGAGTCCCAAG -3'
(R):5'- CTTAGAACATGGAGAAAGGCACGTG -3'
Posted On2015-01-23