Mutagenetix > Incidental Mutations

Incidental Mutation 'R2875:Ndst1'

260534

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

MMRRC Submission

040463-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2875 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 60690047 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 816 (F816I)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

AlphaFold

Q3UHN9

Predicted Effect

probably damaging
Transcript: ENSMUST00000169273
AA Change: F816I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: F816I

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (1/1)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	T	G	10: 10,422,719	T422P	probably damaging	Het
Adrm1	A	G	2: 180,175,618	T293A	probably damaging	Het
Baz1a	A	T	12: 54,923,119	D585E	probably damaging	Het
Ccdc152	T	C	15: 3,298,181	N38S	probably damaging	Het
Cenpf	A	G	1: 189,658,644	M997T	probably benign	Het
Dnah12	A	G	14: 26,693,470	I9V	probably benign	Het
Dnah12	A	G	14: 26,876,950	N995S	probably benign	Het
Dnah9	C	A	11: 66,168,461	G3C	possibly damaging	Het
Dock2	A	G	11: 34,718,885	S243P	probably damaging	Het
Eif2ak3	T	C	6: 70,883,639	S400P	probably damaging	Het
Eno1b	A	G	18: 48,047,784	K343R	possibly damaging	Het
Gm38394	C	T	1: 133,656,860	C913Y	probably damaging	Het
Gm5346	T	A	8: 43,627,140	K16*	probably null	Het
Grk6	A	G	13: 55,452,304	H271R	probably damaging	Het
H2-Ab1	A	C	17: 34,263,312	M1L	probably benign	Het
Irf8	C	A	8: 120,754,463	P262Q	probably damaging	Het
Kcnc3	G	T	7: 44,591,537	G218*	probably null	Het
Krt9	C	A	11: 100,189,205	G454*	probably null	Het
Mgrn1	C	T	16: 4,907,416	T47I	possibly damaging	Het
Olfr193	A	T	16: 59,109,802	D269E	probably benign	Het
Olfr742	T	A	14: 50,515,812	W203R	probably benign	Het
Phf12	C	A	11: 78,009,747	T223N	probably damaging	Het
Rad1	T	C	15: 10,490,331	V128A	probably benign	Het
Rad54l	C	T	4: 116,101,853	R382Q	probably benign	Het
Rhbdd1	A	G	1: 82,368,369	D215G	probably benign	Het
Sdc4	T	C	2: 164,431,291	D33G	possibly damaging	Het
Smarca4	A	T	9: 21,642,580	K387N	possibly damaging	Het
St3gal5	A	G	6: 72,147,130	M214V	possibly damaging	Het
Stk25	T	C	1: 93,629,251	D15G	possibly damaging	Het
Timm21	T	C	18: 84,951,092	D69G	probably benign	Het
Ttll4	A	G	1: 74,686,438		probably null	Het
Ttn	T	A	2: 76,759,094	N21272I	probably damaging	Het
Uchl3	A	G	14: 101,668,560	H153R	probably benign	Het
Zcwpw1	T	C	5: 137,810,042	S251P	probably damaging	Het
Zeb1	GGA	GGAAGA	18: 5,772,859		probably benign	Het
Zscan29	T	C	2: 121,164,100	Y468C	probably damaging	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1371:Ndst1	UTSW	18	60707647	missense	possibly damaging	0.90
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1524:Ndst1	UTSW	18	60698504	missense	probably damaging	0.99
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1718:Ndst1	UTSW	18	60707803	missense	probably damaging	0.99
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2079:Ndst1	UTSW	18	60695509	missense	probably damaging	1.00
R2105:Ndst1	UTSW	18	60691253	missense	probably benign	0.01
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R3798:Ndst1	UTSW	18	60713166	missense	possibly damaging	0.94
R3950:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3952:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4868:Ndst1	UTSW	18	60695476	missense	probably benign	0.07
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5337:Ndst1	UTSW	18	60690007	missense	probably damaging	1.00
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R5968:Ndst1	UTSW	18	60713076	missense	probably benign
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7099:Ndst1	UTSW	18	60695500	missense	possibly damaging	0.88
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
R8918:Ndst1	UTSW	18	60692011	missense	probably benign	0.00
R8951:Ndst1	UTSW	18	60697124	missense	probably benign
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGGATGCCTGCTGTGTAAG -3'
(R):5'- ACCAGAGTGACTTAGAACATGG -3'

Sequencing Primer
(F):5'- CTGCTGTGTAAGAGTCCCAAG -3'
(R):5'- CTTAGAACATGGAGAAAGGCACGTG -3'

Posted On

2015-01-23