Mutagenetix > Incidental Mutations

Incidental Mutation 'R2876:Ttll4'

260536

Institutional Source

Beutler Lab

Gene Symbol

Ttll4

Ensembl Gene

ENSMUSG00000033257

Gene Name

tubulin tyrosine ligase-like family, member 4

Synonyms

4632407P03Rik

MMRRC Submission

040464-MU

Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R2876 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74661745-74703730 bp(+) (GRCm38)

Type of Mutation

splice site (1081 bp from exon)

DNA Base Change (assembly)

A to G at 74686438 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000116733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]

AlphaFold

Q80UG8

Predicted Effect

probably null
Transcript: ENSMUST00000042125

SMART Domains

Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	645	940	2.2e-106	PFAM
low complexity region	942	961	N/A	INTRINSIC
low complexity region	1103	1113	N/A	INTRINSIC
low complexity region	1168	1182	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000113678

SMART Domains

Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	636	876	3.4e-82	PFAM
low complexity region	878	897	N/A	INTRINSIC
low complexity region	1039	1049	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000113678

SMART Domains

Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	636	876	3.4e-82	PFAM
low complexity region	878	897	N/A	INTRINSIC
low complexity region	1039	1049	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000129890

SMART Domains

Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	69	101	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140591

Predicted Effect

probably null
Transcript: ENSMUST00000141119

SMART Domains

Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	56	96	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143925

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145132

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155753

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

95% (42/44)

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730507C01Rik	C	A	12: 18,533,643	Q235K	possibly damaging	Het
Abcc1	A	T	16: 14,457,960	H906L	probably benign	Het
Acot6	T	G	12: 84,101,262	D97E	possibly damaging	Het
Acvr2a	T	A	2: 48,892,178	M241K	probably damaging	Het
Adamts9	T	C	6: 92,795,910		probably benign	Het
Adgb	T	G	10: 10,422,719	T422P	probably damaging	Het
Adrm1	A	G	2: 180,175,618	T293A	probably damaging	Het
Ankfn1	A	G	11: 89,391,636	V395A	possibly damaging	Het
Atp2b1	A	G	10: 98,999,745	M451V	probably damaging	Het
Ccdc152	T	C	15: 3,298,181	N38S	probably damaging	Het
Cdh23	A	T	10: 60,307,496	N3017K	probably damaging	Het
Cenpf	A	G	1: 189,658,644	M997T	probably benign	Het
Gcc2	A	G	10: 58,290,302	E1344G	probably damaging	Het
Gen1	A	C	12: 11,242,068	S573R	probably benign	Het
Gm38394	C	T	1: 133,656,860	C913Y	probably damaging	Het
Ilvbl	C	A	10: 78,583,056	Q410K	probably benign	Het
Ints11	C	A	4: 155,887,425		probably benign	Het
Itfg1	T	C	8: 85,780,510		probably benign	Het
Lrrc27	C	T	7: 139,228,684		probably benign	Het
Maml3	G	A	3: 51,690,059	A422V	possibly damaging	Het
Masp2	T	A	4: 148,608,001	I317K	probably benign	Het
Olfr154	A	G	2: 85,663,690	V248A	probably damaging	Het
Olfr700	C	G	7: 106,805,997	S155T	probably benign	Het
Olfr702	A	T	7: 106,824,457	V23E	probably benign	Het
Papln	T	A	12: 83,778,927	S661T	probably damaging	Het
Pi4ka	A	G	16: 17,367,550	S229P	possibly damaging	Het
Piezo2	A	G	18: 63,053,035	S1688P	probably damaging	Het
Pzp	T	C	6: 128,491,550	T1005A	probably damaging	Het
Rad1	T	C	15: 10,490,331	V128A	probably benign	Het
Rhbdd1	A	G	1: 82,368,369	D215G	probably benign	Het
Rnft2	G	A	5: 118,193,621	R417C	probably damaging	Het
Scn2a	A	C	2: 65,715,897	I935L	possibly damaging	Het
Sdc4	T	C	2: 164,431,291	D33G	possibly damaging	Het
Slco1c1	T	C	6: 141,559,856	S454P	probably damaging	Het
Spidr	A	T	16: 15,912,589		probably null	Het
Srp72	T	A	5: 76,995,920		probably benign	Het
Ttn	C	T	2: 76,920,340	S3455N	probably damaging	Het
Vcan	T	A	13: 89,704,237	E868V	probably damaging	Het
Vmn2r89	G	T	14: 51,455,084	G115C	possibly damaging	Het
Zscan29	T	C	2: 121,164,100	Y468C	probably damaging	Het

Other mutations in Ttll4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Ttll4	APN	1	74685893	missense	probably damaging	1.00
IGL01743:Ttll4	APN	1	74688193	missense	possibly damaging	0.63
IGL01914:Ttll4	APN	1	74679058	missense	probably benign	0.01
IGL02288:Ttll4	APN	1	74679401	missense	probably benign	0.05
IGL02621:Ttll4	APN	1	74687484	missense	probably damaging	1.00
IGL02662:Ttll4	APN	1	74687231	splice site	probably null
IGL02890:Ttll4	APN	1	74687339	nonsense	probably null
IGL02937:Ttll4	APN	1	74679503	missense	possibly damaging	0.92
IGL03178:Ttll4	APN	1	74680408	missense	probably damaging	0.96
IGL03412:Ttll4	APN	1	74687321	missense	probably benign	0.28
1mM(1):Ttll4	UTSW	1	74689980	missense	probably null	1.00
R0083:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0108:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0135:Ttll4	UTSW	1	74679928	missense	possibly damaging	0.86
R0137:Ttll4	UTSW	1	74679692	missense	possibly damaging	0.74
R0306:Ttll4	UTSW	1	74696757	missense	probably benign	0.28
R0506:Ttll4	UTSW	1	74688618	missense	probably benign	0.06
R0555:Ttll4	UTSW	1	74688280	missense	probably damaging	1.00
R1617:Ttll4	UTSW	1	74679401	missense	probably benign	0.05
R1649:Ttll4	UTSW	1	74697470	missense	possibly damaging	0.52
R1793:Ttll4	UTSW	1	74687840	missense	possibly damaging	0.91
R1898:Ttll4	UTSW	1	74697482	missense	probably benign	0.01
R1952:Ttll4	UTSW	1	74687559	missense	probably damaging	0.99
R1987:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R1989:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R2067:Ttll4	UTSW	1	74680382	missense	possibly damaging	0.94
R2162:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R2185:Ttll4	UTSW	1	74679829	missense	possibly damaging	0.54
R2875:Ttll4	UTSW	1	74686438	splice site	probably null
R2895:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R2896:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R3157:Ttll4	UTSW	1	74697611	missense	possibly damaging	0.81
R3832:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R4707:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4784:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4785:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R5176:Ttll4	UTSW	1	74679286	missense	probably damaging	0.99
R5202:Ttll4	UTSW	1	74687852	critical splice donor site	probably null
R5244:Ttll4	UTSW	1	74696448	missense	probably benign	0.30
R5264:Ttll4	UTSW	1	74686376	missense	possibly damaging	0.92
R5452:Ttll4	UTSW	1	74679321	missense	probably benign	0.06
R5992:Ttll4	UTSW	1	74685391	missense	probably damaging	1.00
R6111:Ttll4	UTSW	1	74697539	missense	possibly damaging	0.95
R6722:Ttll4	UTSW	1	74681789	missense	possibly damaging	0.95
R6776:Ttll4	UTSW	1	74681353	missense	probably damaging	1.00
R6815:Ttll4	UTSW	1	74679349	missense	possibly damaging	0.89
R6836:Ttll4	UTSW	1	74689413	missense	probably damaging	0.98
R6963:Ttll4	UTSW	1	74681816	missense	probably damaging	1.00
R7271:Ttll4	UTSW	1	74688661	missense	possibly damaging	0.83
R7508:Ttll4	UTSW	1	74687259	missense	possibly damaging	0.81
R7714:Ttll4	UTSW	1	74679413	missense	probably benign	0.00
R7837:Ttll4	UTSW	1	74681757	critical splice acceptor site	probably null
R8032:Ttll4	UTSW	1	74696473	missense	possibly damaging	0.82
R8036:Ttll4	UTSW	1	74679230	missense	probably benign	0.02
R8115:Ttll4	UTSW	1	74687330	nonsense	probably null
R8949:Ttll4	UTSW	1	74681816	missense	probably damaging	0.99
R9145:Ttll4	UTSW	1	74679790	missense	probably benign	0.02
R9156:Ttll4	UTSW	1	74680066	missense	probably benign	0.00
R9329:Ttll4	UTSW	1	74685962	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- TTCTGTCCCAGAGTCTGAGC -3'
(R):5'- TACCAGGCTTTTAGGGAATCTAGG -3'

Sequencing Primer
(F):5'- GTCCCAGAGTCTGAGCTGTTC -3'
(R):5'- CCATACTATTTGGGGAGTGGAAGC -3'

Posted On

2015-01-23