Incidental Mutation 'R2876:Olfr154'
ID260543
Institutional Source Beutler Lab
Gene Symbol Olfr154
Ensembl Gene ENSMUSG00000075212
Gene Nameolfactory receptor 154
SynonymsOlfr4-3, GA_x6K02T2Q125-47143827-47142871, 912-93, MOR175-1, OR93
MMRRC Submission 040464-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R2876 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85663377-85664455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85663690 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 248 (V248A)
Ref Sequence ENSEMBL: ENSMUSP00000097502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099918]
Predicted Effect probably damaging
Transcript: ENSMUST00000099918
AA Change: V248A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097502
Gene: ENSMUSG00000075212
AA Change: V248A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.2e-49 PFAM
Pfam:7tm_1 41 290 1.7e-17 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,533,643 Q235K possibly damaging Het
Abcc1 A T 16: 14,457,960 H906L probably benign Het
Acot6 T G 12: 84,101,262 D97E possibly damaging Het
Acvr2a T A 2: 48,892,178 M241K probably damaging Het
Adamts9 T C 6: 92,795,910 probably benign Het
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Ankfn1 A G 11: 89,391,636 V395A possibly damaging Het
Atp2b1 A G 10: 98,999,745 M451V probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cdh23 A T 10: 60,307,496 N3017K probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Gcc2 A G 10: 58,290,302 E1344G probably damaging Het
Gen1 A C 12: 11,242,068 S573R probably benign Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Ilvbl C A 10: 78,583,056 Q410K probably benign Het
Ints11 C A 4: 155,887,425 probably benign Het
Itfg1 T C 8: 85,780,510 probably benign Het
Lrrc27 C T 7: 139,228,684 probably benign Het
Maml3 G A 3: 51,690,059 A422V possibly damaging Het
Masp2 T A 4: 148,608,001 I317K probably benign Het
Olfr700 C G 7: 106,805,997 S155T probably benign Het
Olfr702 A T 7: 106,824,457 V23E probably benign Het
Papln T A 12: 83,778,927 S661T probably damaging Het
Pi4ka A G 16: 17,367,550 S229P possibly damaging Het
Piezo2 A G 18: 63,053,035 S1688P probably damaging Het
Pzp T C 6: 128,491,550 T1005A probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Rnft2 G A 5: 118,193,621 R417C probably damaging Het
Scn2a A C 2: 65,715,897 I935L possibly damaging Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Slco1c1 T C 6: 141,559,856 S454P probably damaging Het
Spidr A T 16: 15,912,589 probably null Het
Srp72 T A 5: 76,995,920 probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn C T 2: 76,920,340 S3455N probably damaging Het
Vcan T A 13: 89,704,237 E868V probably damaging Het
Vmn2r89 G T 14: 51,455,084 G115C possibly damaging Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Olfr154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Olfr154 APN 2 85664356 missense probably benign 0.23
IGL01745:Olfr154 APN 2 85663577 missense possibly damaging 0.76
R1937:Olfr154 UTSW 2 85663997 missense probably benign
R2086:Olfr154 UTSW 2 85663746 missense probably benign
R3881:Olfr154 UTSW 2 85664425 missense probably benign 0.00
R4801:Olfr154 UTSW 2 85664278 missense probably damaging 1.00
R4802:Olfr154 UTSW 2 85664278 missense probably damaging 1.00
R6010:Olfr154 UTSW 2 85664030 missense probably benign 0.00
R6944:Olfr154 UTSW 2 85663851 missense probably benign 0.00
R7089:Olfr154 UTSW 2 85664174 missense possibly damaging 0.79
R7443:Olfr154 UTSW 2 85663568 missense probably damaging 1.00
R7453:Olfr154 UTSW 2 85664180 missense probably benign
R7736:Olfr154 UTSW 2 85664414 missense probably damaging 1.00
R7853:Olfr154 UTSW 2 85664345 missense probably benign
Z1088:Olfr154 UTSW 2 85663616 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTTGAAAGCTGTAGCAAAACTGC -3'
(R):5'- TGTGGTCCAAATCTCATCAATCAC -3'

Sequencing Primer
(F):5'- GCAAAACTGCTTTTCAAATGTCCTG -3'
(R):5'- CTGGCATGTGCAAATACTCAG -3'
Posted On2015-01-23