Incidental Mutation 'R2876:Masp2'
ID260550
Institutional Source Beutler Lab
Gene Symbol Masp2
Ensembl Gene ENSMUSG00000028979
Gene Namemannan-binding lectin serine peptidase 2
SynonymsMASP-2, MAp19
MMRRC Submission 040464-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R2876 (G1)
Quality Score200
Status Validated
Chromosome4
Chromosomal Location148602554-148615499 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148608001 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 317 (I317K)
Ref Sequence ENSEMBL: ENSMUSP00000049729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052060] [ENSMUST00000084125] [ENSMUST00000105701] [ENSMUST00000105702] [ENSMUST00000165113] [ENSMUST00000172073] [ENSMUST00000186729] [ENSMUST00000188134]
Predicted Effect probably benign
Transcript: ENSMUST00000052060
AA Change: I317K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049729
Gene: ENSMUSG00000028979
AA Change: I317K

DomainStartEndE-ValueType
CUB 18 137 4.71e-30 SMART
EGF_CA 138 181 4.32e-10 SMART
CUB 184 296 4.29e-33 SMART
CCP 300 361 1.79e-12 SMART
CCP 366 429 5.4e-7 SMART
Tryp_SPc 443 678 1.3e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084125
SMART Domains Protein: ENSMUSP00000081142
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 273 316 N/A INTRINSIC
low complexity region 321 329 N/A INTRINSIC
low complexity region 342 358 N/A INTRINSIC
low complexity region 368 380 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105701
SMART Domains Protein: ENSMUSP00000101326
Gene: ENSMUSG00000028979

DomainStartEndE-ValueType
CUB 18 137 4.71e-30 SMART
EGF_CA 138 181 4.32e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105702
SMART Domains Protein: ENSMUSP00000101327
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154898
Predicted Effect probably benign
Transcript: ENSMUST00000165113
SMART Domains Protein: ENSMUSP00000129342
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172073
SMART Domains Protein: ENSMUSP00000130963
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 274 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186729
SMART Domains Protein: ENSMUSP00000139547
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
Pfam:RRM_1 1 37 1.8e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188134
SMART Domains Protein: ENSMUSP00000139476
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188380
Predicted Effect probably benign
Transcript: ENSMUST00000188488
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous disruption of the exon encoding the small mannose-binding lectin (MBL)-associated protein results in a defective lectin-mediated complement pathway with a 20% reduction in the ability of serum components to cleave C3 and C4 in the presence of mannose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,533,643 Q235K possibly damaging Het
Abcc1 A T 16: 14,457,960 H906L probably benign Het
Acot6 T G 12: 84,101,262 D97E possibly damaging Het
Acvr2a T A 2: 48,892,178 M241K probably damaging Het
Adamts9 T C 6: 92,795,910 probably benign Het
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Ankfn1 A G 11: 89,391,636 V395A possibly damaging Het
Atp2b1 A G 10: 98,999,745 M451V probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cdh23 A T 10: 60,307,496 N3017K probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Gcc2 A G 10: 58,290,302 E1344G probably damaging Het
Gen1 A C 12: 11,242,068 S573R probably benign Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Ilvbl C A 10: 78,583,056 Q410K probably benign Het
Ints11 C A 4: 155,887,425 probably benign Het
Itfg1 T C 8: 85,780,510 probably benign Het
Lrrc27 C T 7: 139,228,684 probably benign Het
Maml3 G A 3: 51,690,059 A422V possibly damaging Het
Olfr154 A G 2: 85,663,690 V248A probably damaging Het
Olfr700 C G 7: 106,805,997 S155T probably benign Het
Olfr702 A T 7: 106,824,457 V23E probably benign Het
Papln T A 12: 83,778,927 S661T probably damaging Het
Pi4ka A G 16: 17,367,550 S229P possibly damaging Het
Piezo2 A G 18: 63,053,035 S1688P probably damaging Het
Pzp T C 6: 128,491,550 T1005A probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Rnft2 G A 5: 118,193,621 R417C probably damaging Het
Scn2a A C 2: 65,715,897 I935L possibly damaging Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Slco1c1 T C 6: 141,559,856 S454P probably damaging Het
Spidr A T 16: 15,912,589 probably null Het
Srp72 T A 5: 76,995,920 probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn C T 2: 76,920,340 S3455N probably damaging Het
Vcan T A 13: 89,704,237 E868V probably damaging Het
Vmn2r89 G T 14: 51,455,084 G115C possibly damaging Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Masp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Masp2 APN 4 148602729 missense probably benign 0.05
IGL01284:Masp2 APN 4 148614007 missense probably damaging 1.00
IGL02040:Masp2 APN 4 148603813 missense probably damaging 1.00
IGL02243:Masp2 APN 4 148603068 missense probably benign 0.32
IGL02490:Masp2 APN 4 148607943 missense possibly damaging 0.91
IGL02517:Masp2 APN 4 148614020 missense probably damaging 1.00
IGL02997:Masp2 APN 4 148603175 splice site probably benign
R0408:Masp2 UTSW 4 148606039 missense probably benign
R1517:Masp2 UTSW 4 148612106 missense possibly damaging 0.74
R1630:Masp2 UTSW 4 148614033 missense probably benign 0.07
R1634:Masp2 UTSW 4 148614355 missense probably damaging 1.00
R1873:Masp2 UTSW 4 148614495 missense probably damaging 1.00
R2208:Masp2 UTSW 4 148614415 missense probably damaging 1.00
R2283:Masp2 UTSW 4 148606068 missense probably benign 0.00
R3921:Masp2 UTSW 4 148605731 missense possibly damaging 0.95
R4586:Masp2 UTSW 4 148613901 missense probably damaging 1.00
R4753:Masp2 UTSW 4 148612151 missense probably benign 0.00
R4877:Masp2 UTSW 4 148602871 missense probably benign 0.00
R5169:Masp2 UTSW 4 148606114 missense probably damaging 0.96
R5512:Masp2 UTSW 4 148614069 missense probably damaging 1.00
R6161:Masp2 UTSW 4 148614012 missense possibly damaging 0.88
R6291:Masp2 UTSW 4 148602753 missense probably damaging 0.99
R7039:Masp2 UTSW 4 148602586 start codon destroyed probably benign 0.03
R7164:Masp2 UTSW 4 148610115 critical splice acceptor site probably null
R7183:Masp2 UTSW 4 148612157 missense probably benign 0.02
R7417:Masp2 UTSW 4 148605721 missense probably benign 0.02
R7718:Masp2 UTSW 4 148602747 missense probably damaging 1.00
R7748:Masp2 UTSW 4 148605706 missense probably benign 0.00
R7852:Masp2 UTSW 4 148602732 missense probably benign 0.00
R7986:Masp2 UTSW 4 148602826 missense probably damaging 1.00
R8078:Masp2 UTSW 4 148613778 missense probably benign 0.01
R8203:Masp2 UTSW 4 148612142 missense probably benign 0.00
R8257:Masp2 UTSW 4 148603040 missense possibly damaging 0.82
X0025:Masp2 UTSW 4 148602723 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTGGATGACCACCACACG -3'
(R):5'- CCTACAAGAGTGGTTAGGGC -3'

Sequencing Primer
(F):5'- ACGTGAGGCAGGCTCTCTATG -3'
(R):5'- CATCTATAATGGGATCGGATGCCTC -3'
Posted On2015-01-23