Incidental Mutation 'R2876:Ints11'
ID260551
Institutional Source Beutler Lab
Gene Symbol Ints11
Ensembl Gene ENSMUSG00000029034
Gene Nameintegrator complex subunit 11
Synonyms2410006F12Rik, Cpsf3l
MMRRC Submission 040464-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2876 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155869546-155889103 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 155887425 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030901] [ENSMUST00000079031] [ENSMUST00000097737] [ENSMUST00000105584] [ENSMUST00000120794] [ENSMUST00000156460]
Predicted Effect probably benign
Transcript: ENSMUST00000030901
SMART Domains Protein: ENSMUSP00000030901
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
Lactamase_B 16 233 3.38e-17 SMART
Beta-Casp 245 363 6.94e-37 SMART
Pfam:RMMBL 376 418 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079031
SMART Domains Protein: ENSMUSP00000078040
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
PH 265 361 6.35e-16 SMART
low complexity region 377 391 N/A INTRINSIC
ArfGap 399 521 4.62e-56 SMART
low complexity region 554 566 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 628 650 N/A INTRINSIC
low complexity region 669 686 N/A INTRINSIC
ANK 696 725 3.91e-3 SMART
ANK 729 758 2.43e1 SMART
low complexity region 781 796 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097737
SMART Domains Protein: ENSMUSP00000095344
Gene: ENSMUSG00000051557

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 16 124 2.5e-12 PFAM
Pfam:PseudoU_synth_1 168 285 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105584
SMART Domains Protein: ENSMUSP00000101209
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
Pfam:BAR_3 3 236 4.1e-95 PFAM
PH 269 365 6.35e-16 SMART
low complexity region 381 395 N/A INTRINSIC
ArfGap 403 525 4.62e-56 SMART
low complexity region 558 570 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 673 690 N/A INTRINSIC
ANK 700 729 3.91e-3 SMART
ANK 733 762 2.43e1 SMART
low complexity region 785 800 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120794
SMART Domains Protein: ENSMUSP00000112656
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
Lactamase_B 16 211 6.42e-9 SMART
Beta-Casp 223 341 6.94e-37 SMART
Pfam:RMMBL 354 396 3.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142724
Predicted Effect probably benign
Transcript: ENSMUST00000156460
SMART Domains Protein: ENSMUSP00000118803
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
SCOP:d1smla_ 1 66 7e-7 SMART
PDB:2I7V|A 3 38 1e-9 PDB
Blast:Lactamase_B 16 66 4e-30 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Integrator complex contains at least 12 subunits and associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates the 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690). INTS11, or CPSF3L, is the catalytic subunit of the Integrator complex (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,533,643 Q235K possibly damaging Het
Abcc1 A T 16: 14,457,960 H906L probably benign Het
Acot6 T G 12: 84,101,262 D97E possibly damaging Het
Acvr2a T A 2: 48,892,178 M241K probably damaging Het
Adamts9 T C 6: 92,795,910 probably benign Het
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Ankfn1 A G 11: 89,391,636 V395A possibly damaging Het
Atp2b1 A G 10: 98,999,745 M451V probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cdh23 A T 10: 60,307,496 N3017K probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Gcc2 A G 10: 58,290,302 E1344G probably damaging Het
Gen1 A C 12: 11,242,068 S573R probably benign Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Ilvbl C A 10: 78,583,056 Q410K probably benign Het
Itfg1 T C 8: 85,780,510 probably benign Het
Lrrc27 C T 7: 139,228,684 probably benign Het
Maml3 G A 3: 51,690,059 A422V possibly damaging Het
Masp2 T A 4: 148,608,001 I317K probably benign Het
Olfr154 A G 2: 85,663,690 V248A probably damaging Het
Olfr700 C G 7: 106,805,997 S155T probably benign Het
Olfr702 A T 7: 106,824,457 V23E probably benign Het
Papln T A 12: 83,778,927 S661T probably damaging Het
Pi4ka A G 16: 17,367,550 S229P possibly damaging Het
Piezo2 A G 18: 63,053,035 S1688P probably damaging Het
Pzp T C 6: 128,491,550 T1005A probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Rnft2 G A 5: 118,193,621 R417C probably damaging Het
Scn2a A C 2: 65,715,897 I935L possibly damaging Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Slco1c1 T C 6: 141,559,856 S454P probably damaging Het
Spidr A T 16: 15,912,589 probably null Het
Srp72 T A 5: 76,995,920 probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn C T 2: 76,920,340 S3455N probably damaging Het
Vcan T A 13: 89,704,237 E868V probably damaging Het
Vmn2r89 G T 14: 51,455,084 G115C possibly damaging Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Ints11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Ints11 APN 4 155885126 missense probably damaging 1.00
IGL01515:Ints11 APN 4 155875232 missense probably damaging 1.00
IGL01613:Ints11 APN 4 155885198 critical splice donor site probably null
IGL02024:Ints11 APN 4 155888515 missense probably damaging 1.00
IGL02127:Ints11 APN 4 155886863 missense probably damaging 1.00
IGL02850:Ints11 APN 4 155875304 missense probably benign 0.03
IGL02926:Ints11 APN 4 155888111 critical splice donor site probably null
IGL03296:Ints11 APN 4 155885323 critical splice donor site probably null
IGL03357:Ints11 APN 4 155872124 splice site probably benign
R0013:Ints11 UTSW 4 155887168 missense probably damaging 1.00
R0013:Ints11 UTSW 4 155887168 missense probably damaging 1.00
R0449:Ints11 UTSW 4 155887948 missense probably benign 0.17
R0480:Ints11 UTSW 4 155887624 missense probably damaging 1.00
R0589:Ints11 UTSW 4 155886886 missense probably damaging 1.00
R0678:Ints11 UTSW 4 155887753 missense probably damaging 1.00
R0865:Ints11 UTSW 4 155887107 splice site probably null
R1135:Ints11 UTSW 4 155887927 splice site probably null
R1466:Ints11 UTSW 4 155888110 critical splice donor site probably null
R1466:Ints11 UTSW 4 155888110 critical splice donor site probably null
R1658:Ints11 UTSW 4 155887728 missense probably damaging 0.97
R1707:Ints11 UTSW 4 155875198 missense probably benign 0.21
R2199:Ints11 UTSW 4 155875281 missense probably benign 0.07
R4567:Ints11 UTSW 4 155885675 missense probably damaging 1.00
R4900:Ints11 UTSW 4 155888430 missense probably benign 0.01
R4964:Ints11 UTSW 4 155886928 missense probably damaging 1.00
R4966:Ints11 UTSW 4 155886928 missense probably damaging 1.00
R5306:Ints11 UTSW 4 155875208 missense probably damaging 1.00
R5963:Ints11 UTSW 4 155872912 nonsense probably null
R6246:Ints11 UTSW 4 155888089 missense probably benign
R7285:Ints11 UTSW 4 155886111 missense probably damaging 1.00
R7365:Ints11 UTSW 4 155872230 splice site probably null
R7768:Ints11 UTSW 4 155886939 missense probably damaging 0.97
R7774:Ints11 UTSW 4 155885683 missense probably benign 0.00
R7999:Ints11 UTSW 4 155886956 missense probably benign 0.12
R8103:Ints11 UTSW 4 155888230 missense possibly damaging 0.93
Z1088:Ints11 UTSW 4 155886970 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CTCCTTAGAGCTTTAGGGAACC -3'
(R):5'- GGCGCTGAAGGACATGTATTC -3'

Sequencing Primer
(F):5'- CAAAGCCCTTGGACTTTGT -3'
(R):5'- CGCTGAAGGACATGTATTCCACTTG -3'
Posted On2015-01-23