Incidental Mutation 'R2876:Olfr702'
ID260559
Institutional Source Beutler Lab
Gene Symbol Olfr702
Ensembl Gene ENSMUSG00000056863
Gene Nameolfactory receptor 702
SynonymsMOR260-4, GA_x6K02T2PBJ9-9202245-9201289
MMRRC Submission 040464-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2876 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106823489-106833893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106824457 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 23 (V23E)
Ref Sequence ENSEMBL: ENSMUSP00000151862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075414] [ENSMUST00000080899] [ENSMUST00000208864] [ENSMUST00000208895] [ENSMUST00000217739] [ENSMUST00000219803]
Predicted Effect probably benign
Transcript: ENSMUST00000075414
SMART Domains Protein: ENSMUSP00000074868
Gene: ENSMUSG00000036744

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-46 PFAM
Pfam:7tm_1 41 290 2.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080899
AA Change: V23E

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000079704
Gene: ENSMUSG00000056863
AA Change: V23E

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 300 2.9e-8 PFAM
Pfam:7tm_1 41 290 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208864
AA Change: V23E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000208895
AA Change: V23E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000217739
Predicted Effect probably benign
Transcript: ENSMUST00000219803
AA Change: V23E

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,533,643 Q235K possibly damaging Het
Abcc1 A T 16: 14,457,960 H906L probably benign Het
Acot6 T G 12: 84,101,262 D97E possibly damaging Het
Acvr2a T A 2: 48,892,178 M241K probably damaging Het
Adamts9 T C 6: 92,795,910 probably benign Het
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Ankfn1 A G 11: 89,391,636 V395A possibly damaging Het
Atp2b1 A G 10: 98,999,745 M451V probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cdh23 A T 10: 60,307,496 N3017K probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Gcc2 A G 10: 58,290,302 E1344G probably damaging Het
Gen1 A C 12: 11,242,068 S573R probably benign Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Ilvbl C A 10: 78,583,056 Q410K probably benign Het
Ints11 C A 4: 155,887,425 probably benign Het
Itfg1 T C 8: 85,780,510 probably benign Het
Lrrc27 C T 7: 139,228,684 probably benign Het
Maml3 G A 3: 51,690,059 A422V possibly damaging Het
Masp2 T A 4: 148,608,001 I317K probably benign Het
Olfr154 A G 2: 85,663,690 V248A probably damaging Het
Olfr700 C G 7: 106,805,997 S155T probably benign Het
Papln T A 12: 83,778,927 S661T probably damaging Het
Pi4ka A G 16: 17,367,550 S229P possibly damaging Het
Piezo2 A G 18: 63,053,035 S1688P probably damaging Het
Pzp T C 6: 128,491,550 T1005A probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Rnft2 G A 5: 118,193,621 R417C probably damaging Het
Scn2a A C 2: 65,715,897 I935L possibly damaging Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Slco1c1 T C 6: 141,559,856 S454P probably damaging Het
Spidr A T 16: 15,912,589 probably null Het
Srp72 T A 5: 76,995,920 probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn C T 2: 76,920,340 S3455N probably damaging Het
Vcan T A 13: 89,704,237 E868V probably damaging Het
Vmn2r89 G T 14: 51,455,084 G115C possibly damaging Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Olfr702
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Olfr702 APN 7 106824029 missense probably benign 0.01
IGL02120:Olfr702 APN 7 106823698 missense possibly damaging 0.94
R0025:Olfr702 UTSW 7 106823756 missense possibly damaging 0.74
R1213:Olfr702 UTSW 7 106824197 missense possibly damaging 0.48
R1830:Olfr702 UTSW 7 106824110 missense probably benign 0.00
R2216:Olfr702 UTSW 7 106823998 missense probably damaging 0.99
R2571:Olfr702 UTSW 7 106823726 missense probably benign 0.09
R2920:Olfr702 UTSW 7 106824364 missense probably benign 0.11
R4082:Olfr702 UTSW 7 106824038 missense possibly damaging 0.78
R4130:Olfr702 UTSW 7 106823585 missense probably benign 0.01
R4750:Olfr702 UTSW 7 106824307 missense probably damaging 0.98
R5007:Olfr702 UTSW 7 106824157 missense probably damaging 1.00
R5117:Olfr702 UTSW 7 106823662 missense probably damaging 0.99
R5908:Olfr702 UTSW 7 106824197 missense probably benign 0.09
R6824:Olfr702 UTSW 7 106824457 missense probably benign 0.00
R7193:Olfr702 UTSW 7 106824591 start gained probably benign
R7254:Olfr702 UTSW 7 106823570 makesense probably null
R7827:Olfr702 UTSW 7 106823725 missense probably benign 0.01
R8309:Olfr702 UTSW 7 106824413 missense probably benign 0.00
R8410:Olfr702 UTSW 7 106824538 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GACATAACTGCCAGCAGAGC -3'
(R):5'- ACTGGCACCTAGTGGAAAAG -3'

Sequencing Primer
(F):5'- CCTGCTAGGAGAAAGACAACTATCTG -3'
(R):5'- CTGGCACCTAGTGGAAAAGAGATG -3'
Posted On2015-01-23