Incidental Mutation 'R2876:Itfg1'
ID260560
Institutional Source Beutler Lab
Gene Symbol Itfg1
Ensembl Gene ENSMUSG00000031703
Gene Nameintegrin alpha FG-GAP repeat containing 1
SynonymsD8Wsu49e, 2310047C21Rik
MMRRC Submission 040464-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R2876 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85717578-85840921 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 85780510 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034140]
Predicted Effect probably benign
Transcript: ENSMUST00000034140
SMART Domains Protein: ENSMUSP00000034140
Gene: ENSMUSG00000031703

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCOP:d1m1xa4 46 232 5e-3 SMART
low complexity region 482 496 N/A INTRINSIC
transmembrane domain 564 586 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,533,643 Q235K possibly damaging Het
Abcc1 A T 16: 14,457,960 H906L probably benign Het
Acot6 T G 12: 84,101,262 D97E possibly damaging Het
Acvr2a T A 2: 48,892,178 M241K probably damaging Het
Adamts9 T C 6: 92,795,910 probably benign Het
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Ankfn1 A G 11: 89,391,636 V395A possibly damaging Het
Atp2b1 A G 10: 98,999,745 M451V probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cdh23 A T 10: 60,307,496 N3017K probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Gcc2 A G 10: 58,290,302 E1344G probably damaging Het
Gen1 A C 12: 11,242,068 S573R probably benign Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Ilvbl C A 10: 78,583,056 Q410K probably benign Het
Ints11 C A 4: 155,887,425 probably benign Het
Lrrc27 C T 7: 139,228,684 probably benign Het
Maml3 G A 3: 51,690,059 A422V possibly damaging Het
Masp2 T A 4: 148,608,001 I317K probably benign Het
Olfr154 A G 2: 85,663,690 V248A probably damaging Het
Olfr700 C G 7: 106,805,997 S155T probably benign Het
Olfr702 A T 7: 106,824,457 V23E probably benign Het
Papln T A 12: 83,778,927 S661T probably damaging Het
Pi4ka A G 16: 17,367,550 S229P possibly damaging Het
Piezo2 A G 18: 63,053,035 S1688P probably damaging Het
Pzp T C 6: 128,491,550 T1005A probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Rnft2 G A 5: 118,193,621 R417C probably damaging Het
Scn2a A C 2: 65,715,897 I935L possibly damaging Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Slco1c1 T C 6: 141,559,856 S454P probably damaging Het
Spidr A T 16: 15,912,589 probably null Het
Srp72 T A 5: 76,995,920 probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn C T 2: 76,920,340 S3455N probably damaging Het
Vcan T A 13: 89,704,237 E868V probably damaging Het
Vmn2r89 G T 14: 51,455,084 G115C possibly damaging Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Itfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Itfg1 APN 8 85780565 missense possibly damaging 0.95
IGL02803:Itfg1 APN 8 85725511 splice site probably null
R0368:Itfg1 UTSW 8 85764407 missense probably damaging 1.00
R0755:Itfg1 UTSW 8 85726205 missense possibly damaging 0.90
R1183:Itfg1 UTSW 8 85780523 missense probably benign 0.04
R1529:Itfg1 UTSW 8 85810614 missense probably benign 0.02
R1789:Itfg1 UTSW 8 85725512 critical splice donor site probably null
R1953:Itfg1 UTSW 8 85831231 missense probably benign 0.31
R2206:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2207:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2260:Itfg1 UTSW 8 85722677 missense probably damaging 1.00
R2358:Itfg1 UTSW 8 85738129 missense probably damaging 1.00
R2990:Itfg1 UTSW 8 85835049 missense possibly damaging 0.82
R4484:Itfg1 UTSW 8 85726249 missense probably damaging 1.00
R4762:Itfg1 UTSW 8 85732441 missense possibly damaging 0.95
R5146:Itfg1 UTSW 8 85718868 makesense probably null
R5796:Itfg1 UTSW 8 85718893 missense probably damaging 1.00
R5805:Itfg1 UTSW 8 85766972 missense probably benign 0.04
R6084:Itfg1 UTSW 8 85726170 missense probably benign 0.01
R6187:Itfg1 UTSW 8 85836465 missense probably damaging 1.00
R6319:Itfg1 UTSW 8 85840629 missense probably damaging 1.00
R6463:Itfg1 UTSW 8 85736151 missense probably benign 0.03
R6490:Itfg1 UTSW 8 85740301 missense probably benign 0.08
R6492:Itfg1 UTSW 8 85740349 missense probably benign 0.14
R6588:Itfg1 UTSW 8 85736130 missense probably benign
R6753:Itfg1 UTSW 8 85835078 missense probably benign 0.04
R7489:Itfg1 UTSW 8 85767001 missense probably damaging 1.00
R7665:Itfg1 UTSW 8 85764350 missense probably benign
R7912:Itfg1 UTSW 8 85764280 missense probably damaging 1.00
R7985:Itfg1 UTSW 8 85725568 missense probably damaging 1.00
X0067:Itfg1 UTSW 8 85840753 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGTGGACCTGATGCTTAACTAG -3'
(R):5'- GCTGGGAACAACTGTTTCTGAC -3'

Sequencing Primer
(F):5'- TTAACTAGCACTTCAGCATTCAGC -3'
(R):5'- CTGGGAACAACTGTTTCTGACAATAC -3'
Posted On2015-01-23