Incidental Mutation 'R2876:Ilvbl'
ID260564
Institutional Source Beutler Lab
Gene Symbol Ilvbl
Ensembl Gene ENSMUSG00000032763
Gene NameilvB (bacterial acetolactate synthase)-like
Synonyms
MMRRC Submission 040464-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R2876 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78574346-78584502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78583056 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 410 (Q410K)
Ref Sequence ENSEMBL: ENSMUSP00000151263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040580] [ENSMUST00000105384] [ENSMUST00000218215] [ENSMUST00000218271] [ENSMUST00000218875] [ENSMUST00000218885] [ENSMUST00000220430]
Predicted Effect probably benign
Transcript: ENSMUST00000040580
SMART Domains Protein: ENSMUSP00000043085
Gene: ENSMUSG00000032714

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 56 69 N/A INTRINSIC
low complexity region 114 127 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
RhoGAP 411 601 1.49e-56 SMART
low complexity region 638 652 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105384
AA Change: Q410K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101023
Gene: ENSMUSG00000032763
AA Change: Q410K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:TPP_enzyme_N 52 220 1.4e-53 PFAM
Pfam:TPP_enzyme_M 273 405 2.1e-16 PFAM
Pfam:TPP_enzyme_C 467 618 3.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218215
AA Change: Q410K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218670
Predicted Effect probably benign
Transcript: ENSMUST00000218875
AA Change: Q410K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218885
AA Change: Q410K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect unknown
Transcript: ENSMUST00000219588
AA Change: Q281K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219971
Predicted Effect probably benign
Transcript: ENSMUST00000220430
Meta Mutation Damage Score 0.0763 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with several thiamine pyrophosphate-binding proteins identified in bacteria, yeast, and plants. The highest degree of similarity is found with bacterial acetolactate synthases (AHAS), which are enzymes that catalyze the first step in branched-chain amino acid biosynthesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,533,643 Q235K possibly damaging Het
Abcc1 A T 16: 14,457,960 H906L probably benign Het
Acot6 T G 12: 84,101,262 D97E possibly damaging Het
Acvr2a T A 2: 48,892,178 M241K probably damaging Het
Adamts9 T C 6: 92,795,910 probably benign Het
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Ankfn1 A G 11: 89,391,636 V395A possibly damaging Het
Atp2b1 A G 10: 98,999,745 M451V probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cdh23 A T 10: 60,307,496 N3017K probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Gcc2 A G 10: 58,290,302 E1344G probably damaging Het
Gen1 A C 12: 11,242,068 S573R probably benign Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Ints11 C A 4: 155,887,425 probably benign Het
Itfg1 T C 8: 85,780,510 probably benign Het
Lrrc27 C T 7: 139,228,684 probably benign Het
Maml3 G A 3: 51,690,059 A422V possibly damaging Het
Masp2 T A 4: 148,608,001 I317K probably benign Het
Olfr154 A G 2: 85,663,690 V248A probably damaging Het
Olfr700 C G 7: 106,805,997 S155T probably benign Het
Olfr702 A T 7: 106,824,457 V23E probably benign Het
Papln T A 12: 83,778,927 S661T probably damaging Het
Pi4ka A G 16: 17,367,550 S229P possibly damaging Het
Piezo2 A G 18: 63,053,035 S1688P probably damaging Het
Pzp T C 6: 128,491,550 T1005A probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Rnft2 G A 5: 118,193,621 R417C probably damaging Het
Scn2a A C 2: 65,715,897 I935L possibly damaging Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Slco1c1 T C 6: 141,559,856 S454P probably damaging Het
Spidr A T 16: 15,912,589 probably null Het
Srp72 T A 5: 76,995,920 probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn C T 2: 76,920,340 S3455N probably damaging Het
Vcan T A 13: 89,704,237 E868V probably damaging Het
Vmn2r89 G T 14: 51,455,084 G115C possibly damaging Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Ilvbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ilvbl APN 10 78583905 missense probably damaging 1.00
IGL00962:Ilvbl APN 10 78583338 missense possibly damaging 0.95
IGL01655:Ilvbl APN 10 78577333 splice site probably benign
IGL01657:Ilvbl APN 10 78576768 missense possibly damaging 0.57
IGL01682:Ilvbl APN 10 78577107 splice site probably benign
IGL01768:Ilvbl APN 10 78583293 missense possibly damaging 0.80
IGL01982:Ilvbl APN 10 78579022 missense probably damaging 1.00
IGL02207:Ilvbl APN 10 78583702 critical splice donor site probably null
IGL02561:Ilvbl APN 10 78577144 missense probably benign 0.01
IGL02985:Ilvbl APN 10 78579067 missense probably benign 0.00
R0398:Ilvbl UTSW 10 78579539 missense probably damaging 0.99
R0557:Ilvbl UTSW 10 78583487 nonsense probably null
R0562:Ilvbl UTSW 10 78583487 missense probably damaging 1.00
R0583:Ilvbl UTSW 10 78583267 missense probably damaging 0.99
R1381:Ilvbl UTSW 10 78576596 missense probably damaging 1.00
R1484:Ilvbl UTSW 10 78576730 missense probably damaging 1.00
R1537:Ilvbl UTSW 10 78579731 missense probably benign 0.31
R1862:Ilvbl UTSW 10 78584124 missense probably benign 0.00
R2474:Ilvbl UTSW 10 78576724 missense probably damaging 1.00
R3621:Ilvbl UTSW 10 78577180 missense probably damaging 1.00
R3811:Ilvbl UTSW 10 78579035 missense probably benign
R4591:Ilvbl UTSW 10 78583305 missense probably benign 0.01
R5040:Ilvbl UTSW 10 78583318 missense probably damaging 1.00
R5449:Ilvbl UTSW 10 78577028 critical splice donor site probably null
R5795:Ilvbl UTSW 10 78577144 missense probably benign 0.01
R5910:Ilvbl UTSW 10 78577113 missense probably benign
R6746:Ilvbl UTSW 10 78577223 missense possibly damaging 0.48
R7019:Ilvbl UTSW 10 78579086 missense probably damaging 0.96
R7223:Ilvbl UTSW 10 78583696 missense probably benign 0.31
R7494:Ilvbl UTSW 10 78579023 missense possibly damaging 0.76
R7576:Ilvbl UTSW 10 78583697 missense possibly damaging 0.45
R7727:Ilvbl UTSW 10 78576666 missense probably benign 0.00
R7777:Ilvbl UTSW 10 78577251 critical splice donor site probably null
R7800:Ilvbl UTSW 10 78583975 missense possibly damaging 0.48
R8082:Ilvbl UTSW 10 78584153 missense probably damaging 0.98
Z1177:Ilvbl UTSW 10 78581124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGAGACTCTTTGAGGGG -3'
(R):5'- AAGCCTTATCCCTGCAACAG -3'

Sequencing Primer
(F):5'- CAGAGACTCTTTGAGGGGCTTCAC -3'
(R):5'- CAACAGGGCAGCAGAAGTC -3'
Posted On2015-01-23