Incidental Mutation 'R2876:Ankfn1'
ID260566
Institutional Source Beutler Lab
Gene Symbol Ankfn1
Ensembl Gene ENSMUSG00000047773
Gene Nameankyrin-repeat and fibronectin type III domain containing 1
SynonymsLOC382543
MMRRC Submission 040464-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R2876 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location89390223-89777653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89391636 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 395 (V395A)
Ref Sequence ENSEMBL: ENSMUSP00000049776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050983]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050983
AA Change: V395A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049776
Gene: ENSMUSG00000047773
AA Change: V395A

DomainStartEndE-ValueType
low complexity region 207 220 N/A INTRINSIC
low complexity region 377 394 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207815
AA Change: V1074A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208932
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (42/44)
MGI Phenotype PHENOTYPE: Mutant mice exhibit a variable and subtle head nodding phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,533,643 Q235K possibly damaging Het
Abcc1 A T 16: 14,457,960 H906L probably benign Het
Acot6 T G 12: 84,101,262 D97E possibly damaging Het
Acvr2a T A 2: 48,892,178 M241K probably damaging Het
Adamts9 T C 6: 92,795,910 probably benign Het
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Atp2b1 A G 10: 98,999,745 M451V probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cdh23 A T 10: 60,307,496 N3017K probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Gcc2 A G 10: 58,290,302 E1344G probably damaging Het
Gen1 A C 12: 11,242,068 S573R probably benign Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Ilvbl C A 10: 78,583,056 Q410K probably benign Het
Ints11 C A 4: 155,887,425 probably benign Het
Itfg1 T C 8: 85,780,510 probably benign Het
Lrrc27 C T 7: 139,228,684 probably benign Het
Maml3 G A 3: 51,690,059 A422V possibly damaging Het
Masp2 T A 4: 148,608,001 I317K probably benign Het
Olfr154 A G 2: 85,663,690 V248A probably damaging Het
Olfr700 C G 7: 106,805,997 S155T probably benign Het
Olfr702 A T 7: 106,824,457 V23E probably benign Het
Papln T A 12: 83,778,927 S661T probably damaging Het
Pi4ka A G 16: 17,367,550 S229P possibly damaging Het
Piezo2 A G 18: 63,053,035 S1688P probably damaging Het
Pzp T C 6: 128,491,550 T1005A probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Rnft2 G A 5: 118,193,621 R417C probably damaging Het
Scn2a A C 2: 65,715,897 I935L possibly damaging Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Slco1c1 T C 6: 141,559,856 S454P probably damaging Het
Spidr A T 16: 15,912,589 probably null Het
Srp72 T A 5: 76,995,920 probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn C T 2: 76,920,340 S3455N probably damaging Het
Vcan T A 13: 89,704,237 E868V probably damaging Het
Vmn2r89 G T 14: 51,455,084 G115C possibly damaging Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Ankfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Ankfn1 APN 11 89391639 missense probably benign 0.01
IGL02519:Ankfn1 APN 11 89405678 missense probably benign
IGL02695:Ankfn1 APN 11 89391819 missense probably damaging 0.99
IGL02818:Ankfn1 APN 11 89538466 missense probably benign
IGL02821:Ankfn1 APN 11 89391616 missense probably benign 0.00
IGL03166:Ankfn1 APN 11 89538438 missense probably benign 0.19
R0056:Ankfn1 UTSW 11 89391676 missense possibly damaging 0.71
R0070:Ankfn1 UTSW 11 89392302 missense probably damaging 0.99
R0070:Ankfn1 UTSW 11 89392302 missense probably damaging 0.99
R0200:Ankfn1 UTSW 11 89441966 missense possibly damaging 0.67
R0427:Ankfn1 UTSW 11 89405597 missense probably damaging 0.99
R0755:Ankfn1 UTSW 11 89392087 missense probably benign
R1240:Ankfn1 UTSW 11 89392134 missense probably damaging 0.99
R1534:Ankfn1 UTSW 11 89523151 missense probably damaging 1.00
R1539:Ankfn1 UTSW 11 89441391 missense probably damaging 1.00
R1548:Ankfn1 UTSW 11 89526541 missense probably damaging 0.98
R1595:Ankfn1 UTSW 11 89422767 critical splice donor site probably null
R1776:Ankfn1 UTSW 11 89526474 missense possibly damaging 0.74
R1835:Ankfn1 UTSW 11 89447618 missense probably benign 0.25
R2012:Ankfn1 UTSW 11 89405597 missense probably damaging 0.99
R2037:Ankfn1 UTSW 11 89456120 missense probably benign 0.13
R2175:Ankfn1 UTSW 11 89526537 missense probably damaging 1.00
R3778:Ankfn1 UTSW 11 89441394 missense probably damaging 1.00
R4720:Ankfn1 UTSW 11 89441426 missense possibly damaging 0.50
R5001:Ankfn1 UTSW 11 89441442 missense possibly damaging 0.85
R5318:Ankfn1 UTSW 11 89391928 missense probably damaging 0.96
R5412:Ankfn1 UTSW 11 89505181 missense probably benign 0.17
R5434:Ankfn1 UTSW 11 89453187 missense probably damaging 1.00
R5458:Ankfn1 UTSW 11 89434810 missense probably benign 0.00
R5710:Ankfn1 UTSW 11 89503925 missense probably benign 0.02
R6457:Ankfn1 UTSW 11 89391844 missense probably benign 0.00
R7026:Ankfn1 UTSW 11 89639577 makesense probably null
R7356:Ankfn1 UTSW 11 89434773 missense probably damaging 0.97
R7499:Ankfn1 UTSW 11 89391750 missense probably benign 0.12
R7572:Ankfn1 UTSW 11 89421271 missense probably benign
R7577:Ankfn1 UTSW 11 89503971 missense probably benign 0.04
R7582:Ankfn1 UTSW 11 89526619 missense probably benign 0.04
R7820:Ankfn1 UTSW 11 89421130 missense probably damaging 0.99
R7908:Ankfn1 UTSW 11 89405534 missense probably damaging 1.00
R7992:Ankfn1 UTSW 11 89523033 missense probably benign 0.02
R8137:Ankfn1 UTSW 11 89453177 missense probably benign 0.00
X0012:Ankfn1 UTSW 11 89425544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGCCTTGTCCGTGTAACC -3'
(R):5'- TTACACCCAGCACCTGTCTCAG -3'

Sequencing Primer
(F):5'- AAAGCCTTGTCCGTGTAACCTTTAG -3'
(R):5'- GCCTGGCTGAAGATCCTG -3'
Posted On2015-01-23