Incidental Mutation 'R2876:5730507C01Rik'
ID260568
Institutional Source Beutler Lab
Gene Symbol 5730507C01Rik
Ensembl Gene ENSMUSG00000073197
Gene NameRIKEN cDNA 5730507C01 gene
Synonyms
MMRRC Submission 040464-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R2876 (G1)
Quality Score122
Status Validated
Chromosome12
Chromosomal Location18514510-18535254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 18533643 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 235 (Q235K)
Ref Sequence ENSEMBL: ENSMUSP00000137525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063216] [ENSMUST00000177778]
Predicted Effect probably benign
Transcript: ENSMUST00000063216
AA Change: Q211K

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099112
Gene: ENSMUSG00000073197
AA Change: Q211K

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
KRAB 45 107 1.74e-14 SMART
ZnF_C2H2 144 166 5.54e1 SMART
ZnF_C2H2 172 194 8.75e0 SMART
ZnF_C2H2 200 222 2.43e-4 SMART
ZnF_C2H2 228 250 2.02e-1 SMART
ZnF_C2H2 256 278 1.4e-4 SMART
ZnF_C2H2 284 306 1.84e-4 SMART
ZnF_C2H2 312 334 6.88e-4 SMART
ZnF_C2H2 340 362 9.58e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177778
AA Change: Q235K

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137525
Gene: ENSMUSG00000073197
AA Change: Q235K

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
KRAB 69 131 1.74e-14 SMART
ZnF_C2H2 168 190 5.54e1 SMART
ZnF_C2H2 196 218 8.75e0 SMART
ZnF_C2H2 224 246 2.43e-4 SMART
ZnF_C2H2 252 274 2.02e-1 SMART
ZnF_C2H2 280 302 1.4e-4 SMART
ZnF_C2H2 308 330 1.84e-4 SMART
ZnF_C2H2 336 358 6.88e-4 SMART
ZnF_C2H2 364 386 9.58e-3 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,457,960 H906L probably benign Het
Acot6 T G 12: 84,101,262 D97E possibly damaging Het
Acvr2a T A 2: 48,892,178 M241K probably damaging Het
Adamts9 T C 6: 92,795,910 probably benign Het
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Ankfn1 A G 11: 89,391,636 V395A possibly damaging Het
Atp2b1 A G 10: 98,999,745 M451V probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cdh23 A T 10: 60,307,496 N3017K probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Gcc2 A G 10: 58,290,302 E1344G probably damaging Het
Gen1 A C 12: 11,242,068 S573R probably benign Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Ilvbl C A 10: 78,583,056 Q410K probably benign Het
Ints11 C A 4: 155,887,425 probably benign Het
Itfg1 T C 8: 85,780,510 probably benign Het
Lrrc27 C T 7: 139,228,684 probably benign Het
Maml3 G A 3: 51,690,059 A422V possibly damaging Het
Masp2 T A 4: 148,608,001 I317K probably benign Het
Olfr154 A G 2: 85,663,690 V248A probably damaging Het
Olfr700 C G 7: 106,805,997 S155T probably benign Het
Olfr702 A T 7: 106,824,457 V23E probably benign Het
Papln T A 12: 83,778,927 S661T probably damaging Het
Pi4ka A G 16: 17,367,550 S229P possibly damaging Het
Piezo2 A G 18: 63,053,035 S1688P probably damaging Het
Pzp T C 6: 128,491,550 T1005A probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Rnft2 G A 5: 118,193,621 R417C probably damaging Het
Scn2a A C 2: 65,715,897 I935L possibly damaging Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Slco1c1 T C 6: 141,559,856 S454P probably damaging Het
Spidr A T 16: 15,912,589 probably null Het
Srp72 T A 5: 76,995,920 probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn C T 2: 76,920,340 S3455N probably damaging Het
Vcan T A 13: 89,704,237 E868V probably damaging Het
Vmn2r89 G T 14: 51,455,084 G115C possibly damaging Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in 5730507C01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:5730507C01Rik APN 12 18533374 missense possibly damaging 0.91
R0419:5730507C01Rik UTSW 12 18533423 missense possibly damaging 0.53
R1662:5730507C01Rik UTSW 12 18531966 missense possibly damaging 0.53
R1851:5730507C01Rik UTSW 12 18533686 missense possibly damaging 0.95
R1902:5730507C01Rik UTSW 12 18534003 nonsense probably null
R3861:5730507C01Rik UTSW 12 18533410 missense probably benign 0.33
R3934:5730507C01Rik UTSW 12 18534081 missense possibly damaging 0.95
R5774:5730507C01Rik UTSW 12 18531667 missense probably damaging 1.00
R6259:5730507C01Rik UTSW 12 18534119 missense probably benign 0.44
R7647:5730507C01Rik UTSW 12 18514802 missense possibly damaging 0.86
R8053:5730507C01Rik UTSW 12 18533727 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCCAATTTTCATTGCAGGTATG -3'
(R):5'- TGGGTTGTGAAAAGGCTTTACC -3'

Sequencing Primer
(F):5'- ATGTTGTAAAGCCTTTCCAACACC -3'
(R):5'- GGTTGTGAAAAGGCTTTACCACATTG -3'
Posted On2015-01-23