Incidental Mutation 'R2876:Rad1'
ID260573
Institutional Source Beutler Lab
Gene Symbol Rad1
Ensembl Gene ENSMUSG00000022248
Gene NameRAD1 checkpoint DNA exonuclease
Synonyms
MMRRC Submission 040464-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R2876 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location10486018-10499063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10490331 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 128 (V128A)
Ref Sequence ENSEMBL: ENSMUSP00000126645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022855] [ENSMUST00000022856] [ENSMUST00000100775] [ENSMUST00000168408] [ENSMUST00000168761] [ENSMUST00000169050] [ENSMUST00000169519] [ENSMUST00000170100]
Predicted Effect probably benign
Transcript: ENSMUST00000022855
SMART Domains Protein: ENSMUSP00000022855
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Brix 63 243 3.62e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022856
AA Change: V128A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000022856
Gene: ENSMUSG00000022248
AA Change: V128A

DomainStartEndE-ValueType
Pfam:Rad1 16 257 2.2e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100775
AA Change: V128A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000098338
Gene: ENSMUSG00000022248
AA Change: V128A

DomainStartEndE-ValueType
Pfam:Rad1 16 235 5.5e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168408
SMART Domains Protein: ENSMUSP00000132747
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 67 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168690
SMART Domains Protein: ENSMUSP00000132283
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Brix 22 147 5.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168761
SMART Domains Protein: ENSMUSP00000130602
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Blast:Brix 10 51 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169050
SMART Domains Protein: ENSMUSP00000127437
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Pfam:Brix 72 154 8.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169519
AA Change: V128A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126645
Gene: ENSMUSG00000022248
AA Change: V128A

DomainStartEndE-ValueType
Pfam:Rad1 16 133 9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170100
AA Change: V98A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128601
Gene: ENSMUSG00000022248
AA Change: V98A

DomainStartEndE-ValueType
Pfam:Rad1 1 161 1.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170531
Meta Mutation Damage Score 0.2799 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a heterotrimeric cell cycle checkpoint complex, known as the 9-1-1 complex, that is activated to stop cell cycle progression in response to DNA damage or incomplete DNA replication. The 9-1-1 complex is recruited by RAD17 to affected sites where it may attract specialized DNA polymerases and other DNA repair effectors. Alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit normal B cell DNA damage sensitivity, somatic hypermutation, and class switch recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,533,643 Q235K possibly damaging Het
Abcc1 A T 16: 14,457,960 H906L probably benign Het
Acot6 T G 12: 84,101,262 D97E possibly damaging Het
Acvr2a T A 2: 48,892,178 M241K probably damaging Het
Adamts9 T C 6: 92,795,910 probably benign Het
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Ankfn1 A G 11: 89,391,636 V395A possibly damaging Het
Atp2b1 A G 10: 98,999,745 M451V probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cdh23 A T 10: 60,307,496 N3017K probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Gcc2 A G 10: 58,290,302 E1344G probably damaging Het
Gen1 A C 12: 11,242,068 S573R probably benign Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Ilvbl C A 10: 78,583,056 Q410K probably benign Het
Ints11 C A 4: 155,887,425 probably benign Het
Itfg1 T C 8: 85,780,510 probably benign Het
Lrrc27 C T 7: 139,228,684 probably benign Het
Maml3 G A 3: 51,690,059 A422V possibly damaging Het
Masp2 T A 4: 148,608,001 I317K probably benign Het
Olfr154 A G 2: 85,663,690 V248A probably damaging Het
Olfr700 C G 7: 106,805,997 S155T probably benign Het
Olfr702 A T 7: 106,824,457 V23E probably benign Het
Papln T A 12: 83,778,927 S661T probably damaging Het
Pi4ka A G 16: 17,367,550 S229P possibly damaging Het
Piezo2 A G 18: 63,053,035 S1688P probably damaging Het
Pzp T C 6: 128,491,550 T1005A probably damaging Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Rnft2 G A 5: 118,193,621 R417C probably damaging Het
Scn2a A C 2: 65,715,897 I935L possibly damaging Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Slco1c1 T C 6: 141,559,856 S454P probably damaging Het
Spidr A T 16: 15,912,589 probably null Het
Srp72 T A 5: 76,995,920 probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn C T 2: 76,920,340 S3455N probably damaging Het
Vcan T A 13: 89,704,237 E868V probably damaging Het
Vmn2r89 G T 14: 51,455,084 G115C possibly damaging Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Rad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Rad1 APN 15 10490409 missense probably benign 0.06
IGL01536:Rad1 APN 15 10493200 missense possibly damaging 0.94
IGL01544:Rad1 APN 15 10490379 missense probably damaging 0.99
IGL02058:Rad1 APN 15 10493275 missense probably benign 0.01
IGL02368:Rad1 APN 15 10493251 missense probably benign 0.19
IGL02793:Rad1 APN 15 10493279 missense probably benign 0.00
IGL02875:Rad1 APN 15 10493279 missense probably benign 0.00
R0271:Rad1 UTSW 15 10490457 splice site probably null
R1874:Rad1 UTSW 15 10488006 missense probably damaging 1.00
R2154:Rad1 UTSW 15 10486635 missense possibly damaging 0.77
R2318:Rad1 UTSW 15 10490409 missense probably benign 0.06
R2369:Rad1 UTSW 15 10486659 missense probably damaging 1.00
R2875:Rad1 UTSW 15 10490331 missense probably benign 0.09
R2915:Rad1 UTSW 15 10486642 missense probably damaging 0.99
R3721:Rad1 UTSW 15 10488026 missense probably benign 0.00
R4754:Rad1 UTSW 15 10493126 intron probably benign
R4931:Rad1 UTSW 15 10492762 intron probably benign
R5274:Rad1 UTSW 15 10487973 splice site probably null
R5640:Rad1 UTSW 15 10495923 missense possibly damaging 0.47
R5885:Rad1 UTSW 15 10488057 missense probably damaging 1.00
R6056:Rad1 UTSW 15 10488074 missense probably damaging 0.99
R6341:Rad1 UTSW 15 10492821 missense probably damaging 0.99
R6420:Rad1 UTSW 15 10488012 missense probably benign 0.00
R7068:Rad1 UTSW 15 10490293 nonsense probably null
R7205:Rad1 UTSW 15 10493257 missense probably benign 0.00
R7312:Rad1 UTSW 15 10493281 missense probably benign 0.00
R7817:Rad1 UTSW 15 10493318 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATGCATGCTAGAAGCTTGGC -3'
(R):5'- GAAGGGTAATCGCACTGACG -3'

Sequencing Primer
(F):5'- CTTGGCAGATAAATTATTCTTGAGGC -3'
(R):5'- GTAATCGCACTGACGTACCTG -3'
Posted On2015-01-23