Incidental Mutation 'R2876:Spidr'
ID260575
Institutional Source Beutler Lab
Gene Symbol Spidr
Ensembl Gene ENSMUSG00000041974
Gene Namescaffolding protein involved in DNA repair
Synonyms2310008H04Rik
MMRRC Submission 040464-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2876 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location15889224-16146851 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 15912589 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040248]
Predicted Effect probably null
Transcript: ENSMUST00000040248
SMART Domains Protein: ENSMUSP00000038820
Gene: ENSMUSG00000041974

DomainStartEndE-ValueType
Pfam:DUF4502 11 390 1.8e-177 PFAM
low complexity region 499 508 N/A INTRINSIC
Pfam:DUF4503 540 921 2.2e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229846
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,533,643 Q235K possibly damaging Het
Abcc1 A T 16: 14,457,960 H906L probably benign Het
Acot6 T G 12: 84,101,262 D97E possibly damaging Het
Acvr2a T A 2: 48,892,178 M241K probably damaging Het
Adamts9 T C 6: 92,795,910 probably benign Het
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Ankfn1 A G 11: 89,391,636 V395A possibly damaging Het
Atp2b1 A G 10: 98,999,745 M451V probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cdh23 A T 10: 60,307,496 N3017K probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Gcc2 A G 10: 58,290,302 E1344G probably damaging Het
Gen1 A C 12: 11,242,068 S573R probably benign Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Ilvbl C A 10: 78,583,056 Q410K probably benign Het
Ints11 C A 4: 155,887,425 probably benign Het
Itfg1 T C 8: 85,780,510 probably benign Het
Lrrc27 C T 7: 139,228,684 probably benign Het
Maml3 G A 3: 51,690,059 A422V possibly damaging Het
Masp2 T A 4: 148,608,001 I317K probably benign Het
Olfr154 A G 2: 85,663,690 V248A probably damaging Het
Olfr700 C G 7: 106,805,997 S155T probably benign Het
Olfr702 A T 7: 106,824,457 V23E probably benign Het
Papln T A 12: 83,778,927 S661T probably damaging Het
Pi4ka A G 16: 17,367,550 S229P possibly damaging Het
Piezo2 A G 18: 63,053,035 S1688P probably damaging Het
Pzp T C 6: 128,491,550 T1005A probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Rnft2 G A 5: 118,193,621 R417C probably damaging Het
Scn2a A C 2: 65,715,897 I935L possibly damaging Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Slco1c1 T C 6: 141,559,856 S454P probably damaging Het
Srp72 T A 5: 76,995,920 probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn C T 2: 76,920,340 S3455N probably damaging Het
Vcan T A 13: 89,704,237 E868V probably damaging Het
Vmn2r89 G T 14: 51,455,084 G115C possibly damaging Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Spidr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Spidr APN 16 15895578 missense probably damaging 1.00
IGL00482:Spidr APN 16 16114969 missense possibly damaging 0.94
IGL01760:Spidr APN 16 15912560 missense possibly damaging 0.71
IGL02142:Spidr APN 16 16048081 missense probably benign 0.25
IGL02392:Spidr APN 16 15889630 makesense probably null
IGL02430:Spidr APN 16 16114910 missense probably damaging 1.00
IGL03110:Spidr APN 16 15889754 missense probably damaging 1.00
R0011:Spidr UTSW 16 15966603 missense probably benign 0.00
R0504:Spidr UTSW 16 16140072 missense possibly damaging 0.73
R0505:Spidr UTSW 16 16037667 missense probably damaging 1.00
R0541:Spidr UTSW 16 15915365 missense probably damaging 1.00
R0675:Spidr UTSW 16 16037634 missense probably damaging 1.00
R0722:Spidr UTSW 16 15912781 missense probably damaging 1.00
R2005:Spidr UTSW 16 16048049 missense probably damaging 1.00
R2133:Spidr UTSW 16 16053273 missense probably benign 0.04
R2249:Spidr UTSW 16 16118923 missense probably damaging 1.00
R3087:Spidr UTSW 16 15968619 missense probably damaging 1.00
R3121:Spidr UTSW 16 16140860 missense probably damaging 1.00
R3765:Spidr UTSW 16 15968640 missense probably benign 0.39
R4896:Spidr UTSW 16 16118942 missense possibly damaging 0.70
R4939:Spidr UTSW 16 16140746 nonsense probably null
R5004:Spidr UTSW 16 16118942 missense possibly damaging 0.70
R5042:Spidr UTSW 16 16118903 missense probably benign 0.09
R5736:Spidr UTSW 16 15897298 missense probably damaging 1.00
R5839:Spidr UTSW 16 16037502 missense probably damaging 1.00
R5970:Spidr UTSW 16 16114869 missense probably damaging 1.00
R6084:Spidr UTSW 16 16140024 missense possibly damaging 0.87
R6386:Spidr UTSW 16 15968560 missense probably benign 0.02
R6572:Spidr UTSW 16 15912516 splice site probably null
R7238:Spidr UTSW 16 15966816 missense probably benign 0.10
R7249:Spidr UTSW 16 15966648 missense probably benign 0.00
R7334:Spidr UTSW 16 16114825 critical splice donor site probably null
R7393:Spidr UTSW 16 16146831 start gained probably benign
R7681:Spidr UTSW 16 15895624 missense probably damaging 1.00
R7818:Spidr UTSW 16 16114865 missense probably damaging 1.00
R8247:Spidr UTSW 16 15968526 critical splice donor site probably null
R8507:Spidr UTSW 16 15968676 missense probably damaging 1.00
X0025:Spidr UTSW 16 15889752 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTTTACACAGAAAAGGATCACTCC -3'
(R):5'- AACACTGGGACAAATTGATGC -3'

Sequencing Primer
(F):5'- GGGTTAATCTAGATTTTAGAGGCAC -3'
(R):5'- CACTGGGACAAATTGATGCAATTG -3'
Posted On2015-01-23