Incidental Mutation 'R0331:Enpp6'
ID26058
Institutional Source Beutler Lab
Gene Symbol Enpp6
Ensembl Gene ENSMUSG00000038173
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 6
Synonyms4833421B01Rik, D8Ertd514e, Npp6, B830047L21Rik
MMRRC Submission 038540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R0331 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46986887-47096762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 47082449 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 343 (T343K)
Ref Sequence ENSEMBL: ENSMUSP00000044608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039840] [ENSMUST00000119686] [ENSMUST00000123066]
Predicted Effect probably damaging
Transcript: ENSMUST00000039840
AA Change: T343K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044608
Gene: ENSMUSG00000038173
AA Change: T343K

DomainStartEndE-ValueType
Pfam:Phosphodiest 26 357 1.3e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119686
AA Change: T343K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112633
Gene: ENSMUSG00000038173
AA Change: T343K

DomainStartEndE-ValueType
Pfam:Phosphodiest 26 357 1.1e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123066
Predicted Effect unknown
Transcript: ENSMUST00000149593
AA Change: T43K
SMART Domains Protein: ENSMUSP00000121470
Gene: ENSMUSG00000038173
AA Change: T43K

DomainStartEndE-ValueType
PDB:4LR2|A 2 74 2e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210466
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.7%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: This gene encodes a member of the nucleotide pyrophosphatase/phosphodiesterase family of enzymes that play an important role in regulating extracellular nucleotide metabolism. The encoded preproprotein undergoes proteolytic processing to generate a glycosylphosphatidylinositol (GPI)-anchored membrane protein that hydrolyzes choline-containing lysophospholipids such as glycerophosphocholine. Mice lacking the encoded protein develop fatty liver and myelin sheath abnormalities. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,229,392 T79S probably benign Het
Abtb1 T C 6: 88,840,702 probably benign Het
Acot12 G A 13: 91,760,064 probably null Het
Adamts4 T A 1: 171,250,972 S54T probably benign Het
Adgrl4 T C 3: 151,497,940 S96P probably benign Het
Aip G T 19: 4,118,247 T40K probably damaging Het
Anapc4 A G 5: 52,855,642 probably benign Het
Asz1 A G 6: 18,103,619 probably benign Het
Atf7ip A G 6: 136,561,163 T465A possibly damaging Het
Atp11a C T 8: 12,816,953 Q127* probably null Het
Axin1 A G 17: 26,143,107 R142G probably damaging Het
B230359F08Rik A G 14: 53,795,748 N38S probably benign Het
Bcat1 T A 6: 145,047,314 E86V probably benign Het
Brd4 G A 17: 32,202,515 P749L probably benign Het
C1ra G A 6: 124,519,435 probably null Het
Capza2 A T 6: 17,665,103 N237I probably benign Het
Cd2ap A T 17: 42,805,301 V556E probably benign Het
Cfap65 G A 1: 74,929,301 P124L probably damaging Het
Cfap65 G T 1: 74,929,302 P124T probably damaging Het
Cftr T C 6: 18,235,226 V488A possibly damaging Het
Ckmt1 A T 2: 121,362,856 probably null Het
Cmya5 T G 13: 93,144,403 E35A possibly damaging Het
Col7a1 A G 9: 108,967,502 probably benign Het
Crmp1 C T 5: 37,265,313 L155F possibly damaging Het
Cyp2d10 T A 15: 82,407,026 T33S probably benign Het
Dhdh T C 7: 45,488,120 K48E probably benign Het
Dlst T C 12: 85,118,812 V103A probably damaging Het
Dohh C T 10: 81,387,812 T233I probably benign Het
Dvl2 C A 11: 70,006,217 probably benign Het
Eipr1 C T 12: 28,864,704 Q286* probably null Het
Fbxw11 T A 11: 32,711,895 F112I probably damaging Het
Gdpd4 T A 7: 97,973,008 N231K probably benign Het
Gm6370 A T 5: 146,493,766 T254S probably benign Het
Hapln4 G T 8: 70,084,509 Q31H probably damaging Het
Hic1 T A 11: 75,165,490 T858S possibly damaging Het
Isg20l2 T C 3: 87,931,785 L101P probably damaging Het
Itga10 T C 3: 96,652,483 Y485H probably damaging Het
Itgal T A 7: 127,306,681 probably null Het
Itln1 T C 1: 171,531,549 N62S probably damaging Het
Kdm4b T C 17: 56,386,289 probably benign Het
Lct T C 1: 128,298,742 probably benign Het
Lman2 A T 13: 55,353,016 H123Q probably damaging Het
Lztr1 T A 16: 17,524,237 probably benign Het
Myo3b G T 2: 70,095,261 G24V probably damaging Het
Nacad T A 11: 6,599,441 Q1250L possibly damaging Het
Ncor2 A T 5: 125,084,917 M431K unknown Het
Nek9 T A 12: 85,327,375 probably benign Het
Neu1 C A 17: 34,934,170 N255K possibly damaging Het
Nf2 T A 11: 4,794,914 T75S probably benign Het
Nipal4 T A 11: 46,150,213 D385V probably damaging Het
Olah T A 2: 3,342,474 N245I probably damaging Het
Olfr474 G T 7: 107,954,870 L76F probably benign Het
Pag1 T A 3: 9,701,970 T90S probably benign Het
Pald1 A G 10: 61,340,929 probably null Het
Parva A G 7: 112,544,798 M98V probably benign Het
Paxbp1 T A 16: 91,037,367 D177V possibly damaging Het
Paxip1 A G 5: 27,765,232 I587T probably damaging Het
Pclo T C 5: 14,680,376 probably benign Het
Pdgfra T A 5: 75,195,052 D1074E probably damaging Het
Pef1 A T 4: 130,127,448 D265V probably damaging Het
Plekhh2 G A 17: 84,586,366 E870K possibly damaging Het
Plscr4 G A 9: 92,482,642 G40D probably damaging Het
Psg18 A G 7: 18,353,308 Y142H probably benign Het
Ptchd3 A T 11: 121,842,191 M636L probably benign Het
Rab2a A G 4: 8,572,559 D51G probably benign Het
Rnf139 T A 15: 58,899,906 D593E probably benign Het
Sept7 A G 9: 25,306,256 N422S probably benign Het
Shprh T C 10: 11,194,170 probably benign Het
Slc7a6os A G 8: 106,210,567 I87T probably damaging Het
Slc7a7 A G 14: 54,377,924 probably benign Het
Spc24 G T 9: 21,757,313 N129K possibly damaging Het
Strip2 C T 6: 29,926,560 T148I probably benign Het
Tmem150c A C 5: 100,086,273 probably null Het
Ttn G T 2: 76,811,020 Y11801* probably null Het
Usp37 A T 1: 74,454,064 L688* probably null Het
Usp38 T C 8: 80,995,840 I351V probably benign Het
Vav2 T A 2: 27,296,175 M223L probably benign Het
Wdr36 A G 18: 32,852,915 I557M possibly damaging Het
Wwc2 A T 8: 47,880,204 M259K probably benign Het
Znfx1 G A 2: 167,046,978 S770L probably benign Het
Other mutations in Enpp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Enpp6 APN 8 47065932 missense probably damaging 1.00
IGL02882:Enpp6 APN 8 47030532 missense probably damaging 1.00
R0025:Enpp6 UTSW 8 47066000 missense probably damaging 0.99
R0025:Enpp6 UTSW 8 47066000 missense probably damaging 0.99
R0525:Enpp6 UTSW 8 47082443 missense possibly damaging 0.68
R1168:Enpp6 UTSW 8 47030454 missense probably damaging 0.96
R1295:Enpp6 UTSW 8 47065500 missense probably benign 0.00
R1533:Enpp6 UTSW 8 47065434 missense probably benign 0.02
R1923:Enpp6 UTSW 8 47082506 missense probably damaging 0.98
R2031:Enpp6 UTSW 8 47053614 missense probably damaging 0.99
R2090:Enpp6 UTSW 8 47065370 critical splice acceptor site probably null
R2656:Enpp6 UTSW 8 47082418 nonsense probably null
R3620:Enpp6 UTSW 8 47065505 missense probably benign 0.03
R3621:Enpp6 UTSW 8 47065505 missense probably benign 0.03
R3862:Enpp6 UTSW 8 47065992 missense probably benign 0.33
R4284:Enpp6 UTSW 8 47069015 missense probably damaging 1.00
R4592:Enpp6 UTSW 8 47093032 missense probably damaging 0.99
R4899:Enpp6 UTSW 8 46987083 missense probably damaging 1.00
R4963:Enpp6 UTSW 8 47065461 missense probably benign 0.30
R5201:Enpp6 UTSW 8 47065451 missense probably damaging 0.99
R5322:Enpp6 UTSW 8 47068915 missense probably benign 0.06
R5933:Enpp6 UTSW 8 47066004 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGGAATAGCCCCGTCAGGGATAATG -3'
(R):5'- CCTCCAGGAAGCAATCGTGTCAAC -3'

Sequencing Primer
(F):5'- TAATGATGAGGGCATCTCCAC -3'
(R):5'- tgaaaggaagccagcagaag -3'
Posted On2013-04-16