Incidental Mutation 'R2877:Kcns1'
ID260590
Institutional Source Beutler Lab
Gene Symbol Kcns1
Ensembl Gene ENSMUSG00000040164
Gene NameK+ voltage-gated channel, subfamily S, 1
SynonymsKv9.1
MMRRC Submission 040465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R2877 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164163619-164171113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164164762 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 427 (I427T)
Ref Sequence ENSEMBL: ENSMUSP00000038901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045196]
Predicted Effect probably damaging
Transcript: ENSMUST00000045196
AA Change: I427T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038901
Gene: ENSMUSG00000040164
AA Change: I427T

DomainStartEndE-ValueType
BTB 19 128 7.07e-7 SMART
low complexity region 160 175 N/A INTRINSIC
Pfam:Ion_trans 188 439 2e-44 PFAM
Pfam:Ion_trans_2 349 433 5e-13 PFAM
low complexity region 455 468 N/A INTRINSIC
Meta Mutation Damage Score 0.9541 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adssl1 A C 12: 112,634,189 K197N probably damaging Het
Alg11 A G 8: 22,065,358 N170D possibly damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Axl T A 7: 25,766,524 M563L probably damaging Het
Carmil2 A G 8: 105,695,423 E1108G probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Eipr1 C T 12: 28,760,092 T22I possibly damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Foxj2 G A 6: 122,842,832 D560N probably damaging Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Ncapd3 T A 9: 27,044,487 probably null Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Olfr1487 A T 19: 13,619,632 I157F probably damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rbak A G 5: 143,174,105 Y398H probably damaging Het
Rcbtb1 A G 14: 59,210,592 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Vmn2r76 C A 7: 86,225,993 C592F probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Kcns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0013:Kcns1 UTSW 2 164168643 missense probably benign 0.00
R0135:Kcns1 UTSW 2 164164955 missense possibly damaging 0.90
R0241:Kcns1 UTSW 2 164168380 missense probably damaging 1.00
R1966:Kcns1 UTSW 2 164168535 missense probably damaging 1.00
R2878:Kcns1 UTSW 2 164164762 missense probably damaging 1.00
R3157:Kcns1 UTSW 2 164164945 missense probably damaging 1.00
R4013:Kcns1 UTSW 2 164168257 missense probably damaging 1.00
R4451:Kcns1 UTSW 2 164168678 missense possibly damaging 0.46
R4873:Kcns1 UTSW 2 164168101 missense probably damaging 1.00
R4875:Kcns1 UTSW 2 164168101 missense probably damaging 1.00
R5270:Kcns1 UTSW 2 164168329 missense probably benign 0.37
R5493:Kcns1 UTSW 2 164167979 missense probably benign 0.02
R5775:Kcns1 UTSW 2 164164766 missense probably damaging 0.99
R6931:Kcns1 UTSW 2 164164838 missense probably damaging 0.99
R7689:Kcns1 UTSW 2 164168321 missense probably damaging 1.00
R8304:Kcns1 UTSW 2 164168102 missense probably damaging 1.00
Z1176:Kcns1 UTSW 2 164168633 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTAGCTGATTCCCAGGCTGTG -3'
(R):5'- AAGAAAACGAGGGCTTTCACAC -3'

Sequencing Primer
(F):5'- AGATTTTGCAGGCTCCCG -3'
(R):5'- GAGGGCTTTCACACAATCCCTG -3'
Posted On2015-01-23