Mutagenetix > Incidental Mutation

Incidental Mutation 'R2877:Trpc4'

260591

Institutional Source

Beutler Lab

Gene Symbol

Trpc4

Ensembl Gene

ENSMUSG00000027748

Gene Name

transient receptor potential cation channel, subfamily C, member 4

Synonyms

Trrp4, STRPC4, Trp4, CCE1

MMRRC Submission

040465-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.171) question?

Stock #

R2877 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54156035-54318471 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 54291340 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 562 (S562P)

Ref Sequence

ENSEMBL: ENSMUSP00000143593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029311] [ENSMUST00000200048] [ENSMUST00000200341]

AlphaFold

Q9QUQ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000029311
AA Change: S562P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000029311
Gene: ENSMUSG00000027748
AA Change: S562P

Domain	Start	End	E-Value	Type
Blast:ANK	33	63	4e-7	BLAST
ANK	69	98	8.72e-1	SMART
ANK	141	170	5.09e-2	SMART
Pfam:TRP_2	176	238	1.2e-30	PFAM
transmembrane domain	328	350	N/A	INTRINSIC
Pfam:Ion_trans	363	632	4.2e-33	PFAM
low complexity region	763	780	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200048
AA Change: S562P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143593
Gene: ENSMUSG00000027748
AA Change: S562P

Domain	Start	End	E-Value	Type
Blast:ANK	33	63	2e-7	BLAST
ANK	69	98	8.72e-1	SMART
ANK	141	170	5.09e-2	SMART
Pfam:TRP_2	176	238	1.1e-30	PFAM
transmembrane domain	328	350	N/A	INTRINSIC
Pfam:Ion_trans	363	632	3.5e-33	PFAM
low complexity region	763	782	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200341

SMART Domains

Protein: ENSMUSP00000142921
Gene: ENSMUSG00000027748

Domain	Start	End	E-Value	Type
Blast:ANK	33	63	2e-7	BLAST
ANK	69	98	8.72e-1	SMART
ANK	141	170	5.09e-2	SMART
Pfam:TRP_2	176	238	6.4e-33	PFAM
transmembrane domain	331	351	N/A	INTRINSIC
transmembrane domain	366	383	N/A	INTRINSIC

Meta Mutation Damage Score

0.6200

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

96% (66/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the canonical subfamily of transient receptor potential cation channels. The encoded protein forms a non-selective calcium-permeable cation channel that is activated by Gq-coupled receptors and tyrosine kinases, and plays a role in multiple processes including endothelial permeability, vasodilation, neurotransmitter release and cell proliferation. Single nucleotide polymorphisms in this gene may be associated with generalized epilepsy with photosensitivity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit a significant reduction in agonist-induced Ca2+ entry and vasorelaxation of aortic rings. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	C	5: 109,738,945		probably benign	Het
Abca13	C	T	11: 9,291,889	L1251F	possibly damaging	Het
Accsl	A	T	2: 93,859,410	M384K	probably damaging	Het
Adssl1	A	C	12: 112,634,189	K197N	probably damaging	Het
Alg11	A	G	8: 22,065,358	N170D	possibly damaging	Het
Ambn	T	C	5: 88,460,700		probably benign	Het
Anapc7	T	C	5: 122,428,156	Y43H	probably benign	Het
Anxa10	T	A	8: 62,060,339	I255F	probably damaging	Het
Atg2b	A	T	12: 105,664,009	Y374*	probably null	Het
Axl	T	A	7: 25,766,524	M563L	probably damaging	Het
Carmil2	A	G	8: 105,695,423	E1108G	probably damaging	Het
Casp1	T	C	9: 5,303,110	M188T	probably damaging	Het
Chd3	A	T	11: 69,361,172	C87*	probably null	Het
Col6a3	G	A	1: 90,775,599	T2475I	unknown	Het
Creb3l4	A	T	3: 90,242,308	S83R	probably damaging	Het
Cyp2a4	G	A	7: 26,312,187	E278K	possibly damaging	Het
Dync1li2	A	C	8: 104,429,415	Y265D	probably damaging	Het
Eif3f	G	A	7: 108,934,812		probably null	Het
Eipr1	C	T	12: 28,760,092	T22I	possibly damaging	Het
Fbxo48	A	G	11: 16,953,382	K3E	possibly damaging	Het
Fbxw13	A	G	9: 109,181,466	F368S	probably damaging	Het
Fbxw19	A	T	9: 109,485,970	W175R	probably damaging	Het
Fibcd1	G	A	2: 31,838,666	P60S	probably benign	Het
Foxa3	A	T	7: 19,014,880	M107K	probably benign	Het
Foxj2	G	A	6: 122,842,832	D560N	probably damaging	Het
Gfm2	A	G	13: 97,153,249	R181G	possibly damaging	Het
Gpr25	C	T	1: 136,260,815	G20D	possibly damaging	Het
Grin1	A	G	2: 25,297,629	V594A	probably damaging	Het
Itpripl1	A	G	2: 127,141,614	V196A	probably benign	Het
Kcns1	A	G	2: 164,164,762	I427T	probably damaging	Het
Kiz	T	C	2: 146,889,556	V322A	possibly damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Muc19	T	A	15: 91,893,006		noncoding transcript	Het
Naa16	A	G	14: 79,343,298	M592T	probably benign	Het
Nat6	A	T	9: 107,583,168	E87D	possibly damaging	Het
Ncapd3	T	A	9: 27,044,487		probably null	Het
Nebl	C	A	2: 17,434,929	D178Y	probably damaging	Het
Nedd1	T	A	10: 92,714,126	N99I	possibly damaging	Het
Nuak1	T	C	10: 84,375,345	D293G	possibly damaging	Het
Olfr1036	T	C	2: 86,075,331	M197T	possibly damaging	Het
Olfr1487	A	T	19: 13,619,632	I157F	probably damaging	Het
Palb2	A	G	7: 122,114,429	V877A	probably damaging	Het
Rassf6	C	T	5: 90,606,805	V205I	probably damaging	Het
Rbak	A	G	5: 143,174,105	Y398H	probably damaging	Het
Rcbtb1	A	G	14: 59,210,592		probably benign	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Smpdl3a	C	A	10: 57,809,085	T317K	probably damaging	Het
Speer4e	C	T	5: 14,937,116	V92M	probably damaging	Het
Syne2	A	G	12: 76,000,831	I4009V	probably benign	Het
Tarbp1	G	A	8: 126,427,832	L1474F	probably damaging	Het
Tchh	A	G	3: 93,444,228	E325G	unknown	Het
Ttn	T	C	2: 76,737,065	D27828G	probably damaging	Het
Ulk4	T	C	9: 121,260,039	D258G	probably benign	Het
Vmn1r215	A	G	13: 23,076,561	H257R	probably benign	Het
Vmn2r56	A	C	7: 12,711,027	M433R	probably benign	Het
Vmn2r76	C	A	7: 86,225,993	C592F	probably benign	Het
Zcchc8	C	T	5: 123,700,703	V591I	probably benign	Het
Znhit6	G	C	3: 145,576,654	G96A	probably benign	Het

Other mutations in Trpc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Trpc4	APN	3	54302175	missense	probably damaging	1.00
IGL01067:Trpc4	APN	3	54222562	missense	probably benign	0.01
IGL01475:Trpc4	APN	3	54266407	missense	possibly damaging	0.87
IGL01544:Trpc4	APN	3	54302146	missense	probably damaging	0.99
IGL01688:Trpc4	APN	3	54266074	splice site	probably benign
IGL02134:Trpc4	APN	3	54315654	missense	possibly damaging	0.46
IGL02237:Trpc4	APN	3	54222362	missense	probably damaging	1.00
IGL02301:Trpc4	APN	3	54291232	missense	probably damaging	0.97
IGL02549:Trpc4	APN	3	54222349	missense	possibly damaging	0.92
IGL02742:Trpc4	APN	3	54299246	missense	probably damaging	1.00
IGL02815:Trpc4	APN	3	54299274	splice site	probably benign
R0498:Trpc4	UTSW	3	54291211	missense	probably damaging	1.00
R0555:Trpc4	UTSW	3	54302090	splice site	probably benign
R0609:Trpc4	UTSW	3	54194768	missense	probably damaging	1.00
R1351:Trpc4	UTSW	3	54195002	missense	probably damaging	1.00
R1595:Trpc4	UTSW	3	54315815	missense	probably benign	0.02
R1623:Trpc4	UTSW	3	54299179	missense	probably damaging	1.00
R1763:Trpc4	UTSW	3	54194822	missense	possibly damaging	0.90
R1843:Trpc4	UTSW	3	54279994	missense	probably benign	0.19
R1856:Trpc4	UTSW	3	54279989	missense	probably damaging	1.00
R1936:Trpc4	UTSW	3	54279890	missense	probably damaging	1.00
R2196:Trpc4	UTSW	3	54302193	missense	probably benign	0.03
R2441:Trpc4	UTSW	3	54222283	missense	probably damaging	0.96
R3846:Trpc4	UTSW	3	54318012	missense	probably benign	0.22
R3931:Trpc4	UTSW	3	54318095	missense	probably damaging	1.00
R4854:Trpc4	UTSW	3	54302218	missense	probably damaging	1.00
R5024:Trpc4	UTSW	3	54194796	missense	probably benign	0.11
R5284:Trpc4	UTSW	3	54279947	missense	probably damaging	0.99
R5320:Trpc4	UTSW	3	54299178	missense	probably damaging	0.99
R5973:Trpc4	UTSW	3	54315842	missense	probably damaging	1.00
R6276:Trpc4	UTSW	3	54318020	missense	probably benign	0.25
R6335:Trpc4	UTSW	3	54317574	critical splice donor site	probably null
R7082:Trpc4	UTSW	3	54299098	nonsense	probably null
R7215:Trpc4	UTSW	3	54194896	missense	possibly damaging	0.83
R7299:Trpc4	UTSW	3	54317627	missense	possibly damaging	0.87
R7423:Trpc4	UTSW	3	54318029	missense	probably benign
R7459:Trpc4	UTSW	3	54291232	missense	probably damaging	0.97
R7538:Trpc4	UTSW	3	54318095	missense	possibly damaging	0.92
R7542:Trpc4	UTSW	3	54315654	missense	probably damaging	1.00
R7823:Trpc4	UTSW	3	54302219	nonsense	probably null
R7868:Trpc4	UTSW	3	54302286	missense	probably benign	0.00
R8046:Trpc4	UTSW	3	54194914	missense	probably damaging	1.00
R8164:Trpc4	UTSW	3	54315805	missense	probably benign	0.31
R8235:Trpc4	UTSW	3	54302248	missense	probably benign	0.01
R8263:Trpc4	UTSW	3	54222335	missense	probably damaging	0.99
R8438:Trpc4	UTSW	3	54222253	missense	possibly damaging	0.90
R8854:Trpc4	UTSW	3	54194701	nonsense	probably null
R8987:Trpc4	UTSW	3	54194711	missense	probably benign	0.09
R9023:Trpc4	UTSW	3	54194833	missense	possibly damaging	0.52
R9196:Trpc4	UTSW	3	54222451	missense	probably damaging	1.00
R9210:Trpc4	UTSW	3	54266320	missense	probably benign	0.07
R9350:Trpc4	UTSW	3	54302189	missense	probably damaging	1.00
R9600:Trpc4	UTSW	3	54194827	nonsense	probably null
R9605:Trpc4	UTSW	3	54318129	missense	probably benign
R9644:Trpc4	UTSW	3	54222278	missense	probably damaging	1.00
R9749:Trpc4	UTSW	3	54194881	missense	probably damaging	1.00
R9755:Trpc4	UTSW	3	54315794	missense	probably damaging	1.00
X0066:Trpc4	UTSW	3	54194750	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTATTGCAAACATCTTCAGTTCC -3'
(R):5'- GAAGTCTATGTTTCTATTCAGAGCC -3'

Sequencing Primer
(F):5'- ACTGCCAATTCTCACCTGGGG -3'
(R):5'- AGAGCCGTGTTAATTCCATTTC -3'

Posted On

2015-01-23