Incidental Mutation 'R2877:Rbak'
ID260601
Institutional Source Beutler Lab
Gene Symbol Rbak
Ensembl Gene ENSMUSG00000061898
Gene NameRB-associated KRAB zinc finger
Synonyms
MMRRC Submission 040465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R2877 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143172186-143180775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143174105 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 398 (Y398H)
Ref Sequence ENSEMBL: ENSMUSP00000128731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049861] [ENSMUST00000165318]
Predicted Effect probably damaging
Transcript: ENSMUST00000049861
AA Change: Y398H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059273
Gene: ENSMUSG00000061898
AA Change: Y398H

DomainStartEndE-ValueType
KRAB 8 68 6.89e-36 SMART
ZnF_C2H2 258 280 1.1e-2 SMART
ZnF_C2H2 286 308 1.4e-4 SMART
ZnF_C2H2 314 336 5.21e-4 SMART
ZnF_C2H2 342 364 1.95e-3 SMART
ZnF_C2H2 370 392 2.3e-5 SMART
ZnF_C2H2 398 420 3.95e-4 SMART
ZnF_C2H2 426 448 5.59e-4 SMART
ZnF_C2H2 454 476 1.12e-3 SMART
ZnF_C2H2 508 528 1.4e1 SMART
ZnF_C2H2 536 558 3.89e-3 SMART
ZnF_C2H2 564 586 1.04e-3 SMART
ZnF_C2H2 592 614 5.42e-2 SMART
ZnF_C2H2 620 642 1.5e-4 SMART
ZnF_C2H2 648 670 9.22e-5 SMART
ZnF_C2H2 676 698 5.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165318
AA Change: Y398H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128731
Gene: ENSMUSG00000061898
AA Change: Y398H

DomainStartEndE-ValueType
KRAB 8 68 6.89e-36 SMART
ZnF_C2H2 258 280 1.1e-2 SMART
ZnF_C2H2 286 308 1.4e-4 SMART
ZnF_C2H2 314 336 5.21e-4 SMART
ZnF_C2H2 342 364 1.95e-3 SMART
ZnF_C2H2 370 392 2.3e-5 SMART
ZnF_C2H2 398 420 3.95e-4 SMART
ZnF_C2H2 426 448 5.59e-4 SMART
ZnF_C2H2 454 476 1.12e-3 SMART
ZnF_C2H2 508 528 1.4e1 SMART
ZnF_C2H2 536 558 3.89e-3 SMART
ZnF_C2H2 564 586 1.04e-3 SMART
ZnF_C2H2 592 614 5.42e-2 SMART
ZnF_C2H2 620 642 1.5e-4 SMART
ZnF_C2H2 648 670 9.22e-5 SMART
ZnF_C2H2 676 698 5.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166382
SMART Domains Protein: ENSMUSP00000132239
Gene: ENSMUSG00000061898

DomainStartEndE-ValueType
KRAB 27 87 6.89e-36 SMART
ZnF_C2H2 277 299 1.1e-2 SMART
ZnF_C2H2 305 327 1.4e-4 SMART
ZnF_C2H2 333 355 5.21e-4 SMART
ZnF_C2H2 361 383 1.95e-3 SMART
ZnF_C2H2 389 411 2.3e-5 SMART
ZnF_C2H2 417 439 3.95e-4 SMART
ZnF_C2H2 445 467 5.59e-4 SMART
ZnF_C2H2 473 495 1.12e-3 SMART
ZnF_C2H2 527 547 1.4e1 SMART
ZnF_C2H2 555 577 3.89e-3 SMART
ZnF_C2H2 583 605 1.04e-3 SMART
ZnF_C2H2 611 633 5.42e-2 SMART
ZnF_C2H2 639 661 1.5e-4 SMART
ZnF_C2H2 667 689 9.22e-5 SMART
ZnF_C2H2 695 717 5.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199880
Meta Mutation Damage Score 0.2308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein which interacts with the tumor suppressor retinoblastoma 1. The two interacting proteins are thought to act as a transcriptional repressor for promoters which are activated by the E2F1 transcription factor. This protein contains a Kruppel-associated box (KRAB), which is a transcriptional repressor motif. Read-through transcripts that include exons from the downstream gene LOC389458 are expressed from this locus. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adssl1 A C 12: 112,634,189 K197N probably damaging Het
Alg11 A G 8: 22,065,358 N170D possibly damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Axl T A 7: 25,766,524 M563L probably damaging Het
Carmil2 A G 8: 105,695,423 E1108G probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Eipr1 C T 12: 28,760,092 T22I possibly damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Foxj2 G A 6: 122,842,832 D560N probably damaging Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Ncapd3 T A 9: 27,044,487 probably null Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Olfr1487 A T 19: 13,619,632 I157F probably damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rcbtb1 A G 14: 59,210,592 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Vmn2r76 C A 7: 86,225,993 C592F probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Rbak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Rbak APN 5 143176600 splice site probably benign
BB001:Rbak UTSW 5 143174486 missense probably damaging 1.00
BB011:Rbak UTSW 5 143174486 missense probably damaging 1.00
R0117:Rbak UTSW 5 143173632 nonsense probably null
R0514:Rbak UTSW 5 143173414 missense probably damaging 0.96
R0945:Rbak UTSW 5 143173579 missense probably damaging 1.00
R1483:Rbak UTSW 5 143174344 missense probably damaging 1.00
R1796:Rbak UTSW 5 143173447 missense probably damaging 1.00
R1916:Rbak UTSW 5 143176116 missense probably damaging 1.00
R1960:Rbak UTSW 5 143174682 nonsense probably null
R2039:Rbak UTSW 5 143173175 missense probably benign 0.37
R2070:Rbak UTSW 5 143176584 missense probably damaging 0.99
R2071:Rbak UTSW 5 143176584 missense probably damaging 0.99
R2151:Rbak UTSW 5 143176502 missense possibly damaging 0.65
R4030:Rbak UTSW 5 143173969 missense probably damaging 1.00
R4584:Rbak UTSW 5 143176123 missense probably benign 0.00
R4612:Rbak UTSW 5 143174467 missense probably benign 0.01
R5229:Rbak UTSW 5 143174162 missense probably damaging 1.00
R5518:Rbak UTSW 5 143173309 missense probably damaging 1.00
R5541:Rbak UTSW 5 143173990 missense probably damaging 1.00
R5873:Rbak UTSW 5 143173711 missense probably benign 0.32
R5908:Rbak UTSW 5 143173636 missense probably damaging 1.00
R6053:Rbak UTSW 5 143174682 nonsense probably null
R6416:Rbak UTSW 5 143176552 missense possibly damaging 0.67
R6693:Rbak UTSW 5 143174111 missense probably damaging 0.97
R7041:Rbak UTSW 5 143173471 missense probably damaging 1.00
R7057:Rbak UTSW 5 143173927 missense possibly damaging 0.81
R7341:Rbak UTSW 5 143176072 missense probably benign 0.01
R7454:Rbak UTSW 5 143173773 nonsense probably null
R7921:Rbak UTSW 5 143174262 missense probably damaging 0.97
R7924:Rbak UTSW 5 143174486 missense probably damaging 1.00
Z1176:Rbak UTSW 5 143176547 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGTGCCTAATGAAAGCAG -3'
(R):5'- GTCGGACTTCAGTACATATCCG -3'

Sequencing Primer
(F):5'- CCACATTCTGTACACTCGTAAGG -3'
(R):5'- CCCTTCGAATGTACACAGTGTGG -3'
Posted On2015-01-23