Incidental Mutation 'R2877:Foxj2'
ID260602
Institutional Source Beutler Lab
Gene Symbol Foxj2
Ensembl Gene ENSMUSG00000003154
Gene Nameforkhead box J2
SynonymsFhx
MMRRC Submission 040465-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.482) question?
Stock #R2877 (G1)
Quality Score190
Status Validated
Chromosome6
Chromosomal Location122819914-122845366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122842832 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 560 (D560N)
Ref Sequence ENSEMBL: ENSMUSP00000137645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003238] [ENSMUST00000042081] [ENSMUST00000177927]
Predicted Effect probably damaging
Transcript: ENSMUST00000003238
AA Change: D560N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003238
Gene: ENSMUSG00000003154
AA Change: D560N

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042081
SMART Domains Protein: ENSMUSP00000048092
Gene: ENSMUSG00000040552

DomainStartEndE-ValueType
Pfam:7tm_1 40 193 8.1e-25 PFAM
Pfam:7TM_GPCR_Srsx 281 443 7.8e-8 PFAM
Pfam:7tm_1 313 428 6.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177927
AA Change: D560N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137645
Gene: ENSMUSG00000003154
AA Change: D560N

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Meta Mutation Damage Score 0.2844 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adssl1 A C 12: 112,634,189 K197N probably damaging Het
Alg11 A G 8: 22,065,358 N170D possibly damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Axl T A 7: 25,766,524 M563L probably damaging Het
Carmil2 A G 8: 105,695,423 E1108G probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Eipr1 C T 12: 28,760,092 T22I possibly damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Ncapd3 T A 9: 27,044,487 probably null Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Olfr1487 A T 19: 13,619,632 I157F probably damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rbak A G 5: 143,174,105 Y398H probably damaging Het
Rcbtb1 A G 14: 59,210,592 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Vmn2r76 C A 7: 86,225,993 C592F probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Foxj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Foxj2 APN 6 122839635 missense probably damaging 1.00
IGL01100:Foxj2 APN 6 122828391 missense probably damaging 1.00
IGL02169:Foxj2 APN 6 122828466 missense probably damaging 0.98
IGL02220:Foxj2 APN 6 122838581 splice site probably benign
IGL02423:Foxj2 APN 6 122842773 missense possibly damaging 0.90
IGL03026:Foxj2 APN 6 122838180 missense probably benign 0.38
IGL03198:Foxj2 APN 6 122833007 critical splice donor site probably null
R0400:Foxj2 UTSW 6 122833808 missense possibly damaging 0.69
R1572:Foxj2 UTSW 6 122833261 missense probably benign 0.00
R2063:Foxj2 UTSW 6 122840241 missense probably benign 0.01
R2568:Foxj2 UTSW 6 122828372 missense probably damaging 1.00
R4745:Foxj2 UTSW 6 122837989 missense probably damaging 1.00
R4763:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4764:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4765:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4775:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R5056:Foxj2 UTSW 6 122833874 missense probably benign 0.00
R5816:Foxj2 UTSW 6 122833736 missense probably benign
R6254:Foxj2 UTSW 6 122838139 missense probably damaging 0.98
R6265:Foxj2 UTSW 6 122828174 missense probably damaging 0.99
R6540:Foxj2 UTSW 6 122833243 missense probably benign
R6882:Foxj2 UTSW 6 122828505 critical splice donor site probably null
R6981:Foxj2 UTSW 6 122828444 missense probably damaging 1.00
R6981:Foxj2 UTSW 6 122842839 missense probably benign 0.14
R7295:Foxj2 UTSW 6 122840231 missense probably benign 0.14
R7475:Foxj2 UTSW 6 122837842 missense probably benign 0.14
R8075:Foxj2 UTSW 6 122838096 nonsense probably null
R8287:Foxj2 UTSW 6 122828267 missense possibly damaging 0.48
R8320:Foxj2 UTSW 6 122833690 missense probably benign 0.05
R8511:Foxj2 UTSW 6 122831445 nonsense probably null
Z1176:Foxj2 UTSW 6 122832936 critical splice acceptor site probably null
Z1176:Foxj2 UTSW 6 122833711 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAGGCTGACTGACTAGACTGTAGG -3'
(R):5'- TATCCTCGGCAGCATCTTGC -3'

Sequencing Primer
(F):5'- ACTAGACTGTAGGCTGACTGTACC -3'
(R):5'- CATCTTGCGGTGGCGTCTC -3'
Posted On2015-01-23