Incidental Mutation 'R2877:Axl'
ID260605
Institutional Source Beutler Lab
Gene Symbol Axl
Ensembl Gene ENSMUSG00000002602
Gene NameAXL receptor tyrosine kinase
SynonymsTyro7, Ufo, Ark
MMRRC Submission 040465-MU
Accession Numbers

Genbank: NM_009465; MGI: 1347244

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2877 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25757273-25788705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25766524 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 563 (M563L)
Ref Sequence ENSEMBL: ENSMUSP00000002677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002677] [ENSMUST00000085948]
Predicted Effect probably damaging
Transcript: ENSMUST00000002677
AA Change: M563L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000002677
Gene: ENSMUSG00000002602
AA Change: M563L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
TyrKc 530 797 1.91e-134 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000085948
AA Change: M554L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083110
Gene: ENSMUSG00000002602
AA Change: M554L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 435 457 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
TyrKc 521 788 1.91e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124442
Predicted Effect unknown
Transcript: ENSMUST00000132038
AA Change: M186L
SMART Domains Protein: ENSMUSP00000114907
Gene: ENSMUSG00000002602
AA Change: M186L

DomainStartEndE-ValueType
Blast:FN3 2 42 8e-20 BLAST
SCOP:d1gh7a2 2 61 4e-7 SMART
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
Pfam:Pkinase_Tyr 154 188 4.1e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137211
Meta Mutation Damage Score 0.3169 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity abnormalities, and aberrant apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adssl1 A C 12: 112,634,189 K197N probably damaging Het
Alg11 A G 8: 22,065,358 N170D possibly damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Carmil2 A G 8: 105,695,423 E1108G probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Eipr1 C T 12: 28,760,092 T22I possibly damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Foxj2 G A 6: 122,842,832 D560N probably damaging Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Ncapd3 T A 9: 27,044,487 probably null Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Olfr1487 A T 19: 13,619,632 I157F probably damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rbak A G 5: 143,174,105 Y398H probably damaging Het
Rcbtb1 A G 14: 59,210,592 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Vmn2r76 C A 7: 86,225,993 C592F probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Axl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Axl APN 7 25785899 missense probably benign 0.16
IGL00428:Axl APN 7 25760872 missense probably damaging 1.00
IGL00725:Axl APN 7 25764483 missense probably damaging 0.97
IGL01348:Axl APN 7 25763309 missense probably damaging 1.00
IGL01350:Axl APN 7 25758750 missense probably damaging 1.00
IGL01357:Axl APN 7 25774169 missense probably benign 0.00
IGL02314:Axl APN 7 25786920 missense possibly damaging 0.50
IGL02321:Axl APN 7 25758769 missense probably damaging 1.00
IGL02839:Axl APN 7 25766791 critical splice donor site probably null
IGL02878:Axl APN 7 25758877 missense probably damaging 0.99
R0125:Axl UTSW 7 25786943 missense probably benign 0.00
R0529:Axl UTSW 7 25787287 splice site probably benign
R0539:Axl UTSW 7 25778717 unclassified probably benign
R0614:Axl UTSW 7 25774163 missense probably benign 0.18
R0747:Axl UTSW 7 25764059 missense possibly damaging 0.95
R1599:Axl UTSW 7 25763969 missense probably damaging 0.99
R1727:Axl UTSW 7 25760766 missense possibly damaging 0.68
R1880:Axl UTSW 7 25774548 missense probably damaging 1.00
R2206:Axl UTSW 7 25770636 missense probably damaging 1.00
R2513:Axl UTSW 7 25787516 missense probably benign
R3802:Axl UTSW 7 25788477 start codon destroyed probably null 0.98
R3915:Axl UTSW 7 25760744 splice site probably benign
R4064:Axl UTSW 7 25764020 missense probably benign 0.36
R4072:Axl UTSW 7 25763911 unclassified probably benign
R4073:Axl UTSW 7 25763911 unclassified probably benign
R4074:Axl UTSW 7 25763911 unclassified probably benign
R4378:Axl UTSW 7 25758837 missense probably benign 0.06
R5039:Axl UTSW 7 25785915 missense probably damaging 1.00
R5224:Axl UTSW 7 25786944 missense probably benign 0.00
R5328:Axl UTSW 7 25773411 missense probably damaging 1.00
R5519:Axl UTSW 7 25778662 missense possibly damaging 0.93
R5885:Axl UTSW 7 25766852 missense probably damaging 1.00
R6367:Axl UTSW 7 25787433 missense probably damaging 1.00
R6447:Axl UTSW 7 25770283 missense probably damaging 0.96
R6931:Axl UTSW 7 25761433 missense probably damaging 1.00
R7172:Axl UTSW 7 25786974 missense probably benign 0.33
R7355:Axl UTSW 7 25774106 missense probably benign 0.22
R7410:Axl UTSW 7 25758783 missense probably benign 0.06
R8274:Axl UTSW 7 25764013 missense probably damaging 0.99
R8279:Axl UTSW 7 25763954 missense probably benign 0.07
R8281:Axl UTSW 7 25763954 missense probably benign 0.07
R8282:Axl UTSW 7 25763954 missense probably benign 0.07
R8283:Axl UTSW 7 25763954 missense probably benign 0.07
X0027:Axl UTSW 7 25770268 missense probably damaging 1.00
Z1177:Axl UTSW 7 25761526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGTGGCAGACATTGGTG -3'
(R):5'- TGTACACATACAGGCGCATAAC -3'

Sequencing Primer
(F):5'- GCTGGTCTCGAACTCAGAAATCTG -3'
(R):5'- GGCGCATAACCCACCAAAATG -3'
Posted On2015-01-23