Incidental Mutation 'R2877:Vmn2r76'
ID260607
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Namevomeronasal 2, receptor 76
Synonyms
MMRRC Submission 040465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R2877 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86225206-86246201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86225993 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 592 (C592F)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
Predicted Effect probably benign
Transcript: ENSMUST00000165771
AA Change: C592F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: C592F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adssl1 A C 12: 112,634,189 K197N probably damaging Het
Alg11 A G 8: 22,065,358 N170D possibly damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Axl T A 7: 25,766,524 M563L probably damaging Het
Carmil2 A G 8: 105,695,423 E1108G probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Eipr1 C T 12: 28,760,092 T22I possibly damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Foxj2 G A 6: 122,842,832 D560N probably damaging Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Ncapd3 T A 9: 27,044,487 probably null Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Olfr1487 A T 19: 13,619,632 I157F probably damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rbak A G 5: 143,174,105 Y398H probably damaging Het
Rcbtb1 A G 14: 59,210,592 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 86228717 missense probably benign
IGL01374:Vmn2r76 APN 7 86225649 missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 86225702 missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 86225663 missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 86230198 missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 86228717 missense probably benign
IGL02214:Vmn2r76 APN 7 86229930 missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 86228863 missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 86230148 missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 86228753 nonsense probably null
IGL02598:Vmn2r76 APN 7 86228671 missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 86225706 missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 86230287 missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 86229826 missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 86228779 missense probably benign 0.01
R0528:Vmn2r76 UTSW 7 86230298 missense possibly damaging 0.80
R0601:Vmn2r76 UTSW 7 86226115 critical splice acceptor site probably null
R0662:Vmn2r76 UTSW 7 86230370 missense probably benign 0.39
R0883:Vmn2r76 UTSW 7 86228696 missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 86230246 missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 86230148 missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 86231256 missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 86231011 missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 86230484 missense probably benign
R2181:Vmn2r76 UTSW 7 86225535 missense probably benign 0.00
R2268:Vmn2r76 UTSW 7 86230499 missense probably benign 0.03
R3155:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R3746:Vmn2r76 UTSW 7 86225555 missense probably benign 0.11
R3799:Vmn2r76 UTSW 7 86226036 missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 86231207 missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 86230300 missense probably benign 0.00
R4237:Vmn2r76 UTSW 7 86230532 missense probably benign 0.00
R4404:Vmn2r76 UTSW 7 86228303 missense probably benign 0.16
R4796:Vmn2r76 UTSW 7 86230444 missense possibly damaging 0.95
R4838:Vmn2r76 UTSW 7 86225525 missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 86228707 missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 86226059 missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 86225288 missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 86225449 missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 86226078 missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 86226053 missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 86245994 critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 86229934 missense probably benign 0.00
R6093:Vmn2r76 UTSW 7 86228261 nonsense probably null
R6651:Vmn2r76 UTSW 7 86228851 missense possibly damaging 0.64
R6741:Vmn2r76 UTSW 7 86230352 missense probably benign
R6750:Vmn2r76 UTSW 7 86225906 missense probably damaging 1.00
R7082:Vmn2r76 UTSW 7 86225232 missense probably benign 0.01
R7136:Vmn2r76 UTSW 7 86228767 missense probably benign 0.06
R7524:Vmn2r76 UTSW 7 86225369 missense probably benign 0.22
R7524:Vmn2r76 UTSW 7 86230166 missense probably benign 0.00
R7611:Vmn2r76 UTSW 7 86230180 missense probably benign 0.04
R7833:Vmn2r76 UTSW 7 86228684 missense probably benign
R8002:Vmn2r76 UTSW 7 86230063 missense probably benign 0.05
R8021:Vmn2r76 UTSW 7 86225750 missense probably damaging 1.00
R8023:Vmn2r76 UTSW 7 86229820 missense probably benign 0.00
R8250:Vmn2r76 UTSW 7 86226023 missense possibly damaging 0.82
R8428:Vmn2r76 UTSW 7 86225271 missense possibly damaging 0.63
Z1176:Vmn2r76 UTSW 7 86246063 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CATGTGAGAATATGTGGTTGTCCAATG -3'
(R):5'- GCTTCCATAAGAAAGGTCAATTTGG -3'

Sequencing Primer
(F):5'- ATGTGGTTGTCCAATGAATAGCAG -3'
(R):5'- TGTTTCAAGTGCCCAGAT -3'
Posted On2015-01-23