Incidental Mutation 'R2877:Carmil2'
ID260614
Institutional Source Beutler Lab
Gene Symbol Carmil2
Ensembl Gene ENSMUSG00000050357
Gene Namecapping protein regulator and myosin 1 linker 2
SynonymsD130029J02Rik, Rltpr
MMRRC Submission 040465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R2877 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105686274-105698187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105695423 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1108 (E1108G)
Ref Sequence ENSEMBL: ENSMUSP00000148422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042608] [ENSMUST00000062574] [ENSMUST00000211870] [ENSMUST00000212642] [ENSMUST00000212650] [ENSMUST00000213019]
Predicted Effect probably benign
Transcript: ENSMUST00000042608
SMART Domains Protein: ENSMUSP00000048180
Gene: ENSMUSG00000038000

DomainStartEndE-ValueType
Pfam:TPP1 11 118 2.4e-23 PFAM
low complexity region 259 272 N/A INTRINSIC
low complexity region 296 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062574
SMART Domains Protein: ENSMUSP00000052322
Gene: ENSMUSG00000050357

DomainStartEndE-ValueType
Pfam:CARMIL_C 149 442 3.3e-62 PFAM
low complexity region 467 484 N/A INTRINSIC
low complexity region 631 659 N/A INTRINSIC
low complexity region 696 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211870
Predicted Effect probably benign
Transcript: ENSMUST00000212642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212643
Predicted Effect probably benign
Transcript: ENSMUST00000212650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212687
Predicted Effect probably damaging
Transcript: ENSMUST00000213019
AA Change: E1108G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1069 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out or ENU-induced allele exhibit decreased regulatory T cells and reduced proliferative and IL2-secretion response to anti-CD3 and anti-CD28 antibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adssl1 A C 12: 112,634,189 K197N probably damaging Het
Alg11 A G 8: 22,065,358 N170D possibly damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Axl T A 7: 25,766,524 M563L probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Eipr1 C T 12: 28,760,092 T22I possibly damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Foxj2 G A 6: 122,842,832 D560N probably damaging Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Ncapd3 T A 9: 27,044,487 probably null Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Olfr1487 A T 19: 13,619,632 I157F probably damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rbak A G 5: 143,174,105 Y398H probably damaging Het
Rcbtb1 A G 14: 59,210,592 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Vmn2r76 C A 7: 86,225,993 C592F probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Carmil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Carmil2 APN 8 105691406 missense probably benign 0.39
IGL01295:Carmil2 APN 8 105695516 missense probably benign 0.44
IGL02055:Carmil2 APN 8 105696907 splice site probably benign
IGL02532:Carmil2 APN 8 105692431 critical splice donor site probably null
IGL02900:Carmil2 APN 8 105695519 missense probably damaging 1.00
IGL03242:Carmil2 APN 8 105691320 splice site probably benign
IGL03335:Carmil2 APN 8 105697029 missense probably benign 0.14
R0544:Carmil2 UTSW 8 105691235 missense probably damaging 1.00
R2160:Carmil2 UTSW 8 105697048 missense possibly damaging 0.94
R2512:Carmil2 UTSW 8 105697393 missense probably benign 0.31
R2943:Carmil2 UTSW 8 105692932 missense probably benign 0.17
R4038:Carmil2 UTSW 8 105695407 missense probably damaging 0.99
R4615:Carmil2 UTSW 8 105695074 missense possibly damaging 0.94
R4914:Carmil2 UTSW 8 105693543 missense possibly damaging 0.85
R5106:Carmil2 UTSW 8 105694006 splice site probably null
R5125:Carmil2 UTSW 8 105696889 missense probably damaging 1.00
R5178:Carmil2 UTSW 8 105696889 missense probably damaging 1.00
R5735:Carmil2 UTSW 8 105698031 missense probably damaging 1.00
R5991:Carmil2 UTSW 8 105691391 missense probably null 1.00
R6035:Carmil2 UTSW 8 105692563 missense probably benign 0.27
R6035:Carmil2 UTSW 8 105692563 missense probably benign 0.27
R6226:Carmil2 UTSW 8 105689032 missense possibly damaging 0.88
R6411:Carmil2 UTSW 8 105697026 missense probably damaging 1.00
R7263:Carmil2 UTSW 8 105693045 missense probably damaging 1.00
R7368:Carmil2 UTSW 8 105690835 missense possibly damaging 0.46
R7409:Carmil2 UTSW 8 105692791 splice site probably null
R7597:Carmil2 UTSW 8 105695489 missense probably damaging 1.00
R7674:Carmil2 UTSW 8 105697286 missense possibly damaging 0.93
R7759:Carmil2 UTSW 8 105697036 missense possibly damaging 0.94
R7864:Carmil2 UTSW 8 105688274 missense probably damaging 1.00
R7921:Carmil2 UTSW 8 105691104 missense probably damaging 1.00
R8057:Carmil2 UTSW 8 105692376 missense probably benign 0.04
R8079:Carmil2 UTSW 8 105686761 missense probably damaging 1.00
R8343:Carmil2 UTSW 8 105691084 missense probably benign 0.05
R8353:Carmil2 UTSW 8 105690211 missense probably damaging 1.00
R8366:Carmil2 UTSW 8 105693075 missense probably benign 0.02
R8453:Carmil2 UTSW 8 105690211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGGTTATTCCTACAGCTGG -3'
(R):5'- TGCTCTCTGTTCCTGAGGAG -3'

Sequencing Primer
(F):5'- AGGATCCAGCCACTGAGG -3'
(R):5'- TGAGGAGCCTCAGCCCC -3'
Posted On2015-01-23